Result : EXP01907

Protein Information

• Protein name: EXP01907
• NCBI Accession ID: CP000480.1
• Organism: Mycolicibacterium smegmatis MC2 155
• Left: 1371126
• Right: 1371260
• Strand: -
• Nucleotide Sequence: GTGCACCTTCTGCAGCGGTGTGACGATCAACAGTTGGAGCCCGAGAGTTGCGAAGAGATCGAGCGCGTACCGTGTCGACACGTCCGATCCGCGCCCGAACGCCTCGTCGATGACGGCGAAGCGGAAGTCGCGTGA
• Sequence: VHLLQRCDDQQLEPESCEEIERVPCRHVRSAPERLVDDGEAEVA
• Source of smORF: Transcriptional-level
• Pubmed ID: 32181921
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 44

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	657119	657253	+	NZ_CP049934.1	Leucobacter insecticola
2	2336093	2336233	+	NZ_AP022616.1	Mycolicibacterium phocaicum
3	4793168	4793302	-	NC_022663.1	Mycobacterium kansasii ATCC 12478

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NZ_CP049934.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF09983.11	1.0	3	117	opposite-strand	Uncharacterized protein conserved in bacteria C-term(DUF2220)
2	PF11795.10	1.0	3	117	opposite-strand	Uncharacterized protein conserved in bacteria N-term (DUF3322)
3	PF13555.8	1.0	3	-134	opposite-strand	P-loop containing region of AAA domain
4	PF13558.8	1.0	3	-134	opposite-strand	Putative exonuclease SbcCD, C subunit
5	PF13835.8	1.0	3	3137	opposite-strand	Domain of unknown function (DUF4194)
6	PF11855.10	1.0	3	3712	opposite-strand	Protein of unknown function (DUF3375)