Result : EXP01900
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01900 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 305144 |
| Right | 305260 |
| Strand | - |
| Nucleotide Sequence | GTGCAGATGATCGGCGCGGCCGGACGCCTCTACATCGGTGGCAGCACCGATGAGGTGACGGTGGCGCGCGATCACATCACCACCGTGCTGAGCGCGATCGAAGGGCAGGAACACTGA |
| Sequence | VQMIGAAGRLYIGGSTDEVTVARDHITTVLSAIEGQEH |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 38 |
++ More..
| Conservation Analysis |
No. of Species: 25
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 317498 | 317614 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 1710953 | 1711069 | - | NZ_CP012150.1 | Mycobacterium goodii |
| 3 | 137880 | 137990 | + | NZ_CP011853.1 | Gordonia phthalatica |
| 4 | 7285214 | 7285324 | + | NZ_CP020809.1 | Mycobacterium dioxanotrophicus |
| 5 | 1561966 | 1562082 | - | NZ_AP022579.1 | Mycolicibacterium boenickei |
| 6 | 252098 | 252214 | - | NZ_CP011269.1 | Mycolicibacterium fortuitum |
| 7 | 4167965 | 4168081 | + | NZ_AP022586.1 | Mycolicibacterium litorale |
| 8 | 4696182 | 4696298 | + | NZ_AP022617.1 | Mycolicibacterium monacense |
| 9 | 1989764 | 1989880 | + | NZ_AP022567.1 | Mycolicibacterium mageritense |
| 10 | 1911446 | 1911562 | - | NZ_AP022598.1 | Mycolicibacterium parafortuitum |
| 11 | 5568057 | 5568173 | + | NZ_LR134356.1 | Mycolicibacterium aurum |
| 12 | 5952122 | 5952238 | + | NC_008726.1 | Mycolicibacterium vanbaalenii PYR-1 |
| 13 | 2019258 | 2019368 | - | NZ_AP022600.1 | Mycolicibacterium tokaiense |
| 14 | 4253254 | 4253370 | - | NZ_AP022593.1 | Mycolicibacterium arabiense |
| 15 | 839182 | 839298 | + | NZ_LR134355.1 | Mycolicibacterium chitae |
| 16 | 173282 | 173398 | + | NZ_AP022570.1 | Mycolicibacterium poriferae |
| 17 | 1369733 | 1369849 | - | NZ_AP022574.1 | Mycolicibacterium psychrotolerans |
| 18 | 4598067 | 4598183 | + | NZ_CP009896.1 | Pimelobacter simplex |
| 19 | 4222129 | 4222245 | + | NZ_LR026975.1 | Mycolicibacterium hassiacum DSM 44199 |
| 20 | 1835140 | 1835250 | + | NZ_AP022595.1 | Mycolicibacterium sarraceniae |
| 21 | 5713455 | 5713571 | + | NZ_CP011491.1 | Mycolicibacterium vaccae 95051 |
| 22 | 2884106 | 2884216 | - | NZ_CP042582.1 | Hypericibacter adhaerens |
| 23 | 2359654 | 2359770 | + | NZ_CP042906.1 | Hypericibacter terrae |
| 24 | 2649660 | 2649776 | - | NZ_CP049037.1 | Pseudohalocynthiibacter aestuariivivens |
| 25 | 2309595 | 2309705 | + | NZ_CP024422.1 | Paracoccus yeei |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07702.15 | 0.8 | 20 | 1850.0 | same-strand | UTRA domain |
| 2 | PF00392.23 | 0.8 | 20 | 1850.0 | same-strand | Bacterial regulatory proteins, gntR family |
| 3 | PF13561.8 | 0.92 | 23 | 1026 | same-strand | Enoyl-(Acyl carrier protein) reductase |
| 4 | PF00106.27 | 0.92 | 23 | 1027 | same-strand | short chain dehydrogenase |
| 5 | PF08659.12 | 0.92 | 23 | 1027 | same-strand | KR domain |
| 6 | PF01636.25 | 0.84 | 21 | 0 | same-strand | Phosphotransferase enzyme family |
| 7 | PF00936.21 | 1.0 | 25 | 1068.5 | same-strand | BMC domain |
| 8 | PF03319.15 | 1.0 | 25 | 883 | same-strand | Ethanolamine utilisation protein EutN/carboxysome |
++ More..