Result : EXP01898
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01898 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 6488454 |
| Right | 6488567 |
| Strand | - |
| Nucleotide Sequence | GTGCGATATCTGGGTTCATGGCCGACGGAATCGGCCGCGGGCGCGCCGCCGCCCCGTCTGGACGAGGCCACCACATGGCTCGAAGGCCTGCGGGCCGGATCGGGTGGCGCATGA |
| Sequence | VRYLGSWPTESAAGAPPPRLDEATTWLEGLRAGSGGA |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 37 |
++ More..
| Conservation Analysis |
No. of Species: 47
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 6505819 | 6505932 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 923813 | 923926 | - | NZ_CP012150.1 | Mycobacterium goodii |
| 3 | 1028444 | 1028557 | - | NZ_AP022579.1 | Mycolicibacterium boenickei |
| 4 | 3979974 | 3980087 | + | NZ_AP022565.1 | Mycolicibacterium alvei |
| 5 | 2928033 | 2928143 | + | NZ_AP022567.1 | Mycolicibacterium mageritense |
| 6 | 5962544 | 5962657 | - | NZ_CP011269.1 | Mycolicibacterium fortuitum |
| 7 | 2597411 | 2597542 | + | NZ_AP022596.1 | Mycolicibacterium helvum |
| 8 | 2633924 | 2634031 | + | NZ_AP022599.1 | Mycolicibacterium pulveris |
| 9 | 963196 | 963315 | - | NZ_CP043474.1 | Mycobacterium grossiae |
| 10 | 1216181 | 1216288 | + | NZ_AP022574.1 | Mycolicibacterium psychrotolerans |
| 11 | 5815937 | 5816044 | - | NZ_CP011491.1 | Mycolicibacterium vaccae 95051 |
| 12 | 464907 | 465014 | + | NZ_CP020809.1 | Mycobacterium dioxanotrophicus |
| 13 | 4744849 | 4744965 | + | NZ_LR026975.1 | Mycolicibacterium hassiacum DSM 44199 |
| 14 | 4063113 | 4063223 | + | NZ_AP022616.1 | Mycolicibacterium phocaicum |
| 15 | 5787311 | 5787421 | - | NZ_CP062008.1 | Mycolicibacterium mucogenicum DSM 44124 |
| 16 | 1872508 | 1872615 | + | NZ_AP022600.1 | Mycolicibacterium tokaiense |
| 17 | 3282889 | 3282999 | - | NZ_AP022569.1 | Mycobacterium cookii |
| 18 | 1615934 | 1616041 | + | NZ_AP022606.1 | Mycobacterium branderi |
| 19 | 5566491 | 5566601 | + | NZ_AP022612.1 | Mycolicibacterium confluentis |
| 20 | 5686496 | 5686603 | - | NZ_LR134356.1 | Mycolicibacterium aurum |
| 21 | 4120511 | 4120636 | + | NZ_AP022593.1 | Mycolicibacterium arabiense |
| 22 | 6054954 | 6055061 | - | NC_008726.1 | Mycolicibacterium vanbaalenii PYR-1 |
| 23 | 197619 | 197729 | + | NZ_AP022561.1 | Mycolicibacterium aichiense |
| 24 | 680151 | 680258 | - | NZ_AP022588.1 | Mycolicibacterium sediminis |
| 25 | 117769 | 117879 | + | NZ_LR134355.1 | Mycolicibacterium chitae |
| 26 | 6639341 | 6639454 | - | NZ_CP025546.1 | Mycobacterium paragordonae |
| 27 | 3111022 | 3111132 | - | NZ_AP022577.1 | Mycolicibacterium aubagnense |
| 28 | 3457495 | 3457620 | - | NZ_AP022573.1 | Mycobacterium saskatchewanense |
| 29 | 5428077 | 5428187 | - | NZ_AP022610.1 | Mycolicibacterium madagascariense |
| 30 | 4740797 | 4740916 | + | NZ_AP022586.1 | Mycolicibacterium litorale |
| 31 | 1755767 | 1755898 | - | NZ_AP022583.1 | Mycobacterium noviomagense |
| 32 | 863889 | 864020 | + | NZ_LR134352.1 | Nocardia asteroides |
| 33 | 127237 | 127353 | + | NZ_AP018165.1 | [Mycobacterium] stephanolepidis |
| 34 | 130710 | 130826 | + | NZ_CP007220.1 | Mycobacteroides chelonae CCUG 47445 |
| 35 | 99875 | 100006 | + | NZ_CP018082.1 | Nocardia mangyaensis |
| 36 | 190573 | 190689 | + | NZ_CP011530.1 | Mycobacteroides immunogenum |
| 37 | 6438687 | 6438818 | - | NZ_CP022088.2 | Nocardia brasiliensis |
| 38 | 82901 | 83014 | + | NC_015564.1 | Hoyosella subflava DQS3-9A1 |
| 39 | 3779486 | 3779596 | - | NZ_CP033972.1 | Gordonia insulae |
| 40 | 5507386 | 5507505 | - | NZ_LR130759.1 | Mycobacterium basiliense |
| 41 | 765125 | 765232 | + | NZ_CP022208.1 | Rhodococcus pyridinivorans |
| 42 | 125858 | 125974 | + | NZ_CP010271.1 | Mycobacteroides saopaulense |
| 43 | 113506 | 113622 | + | NZ_CP024633.1 | Mycobacteroides salmoniphilum |
| 44 | 130206 | 130322 | + | NZ_CP014955.1 | Mycobacteroides abscessus |
| 45 | 164638 | 164745 | + | NZ_LT906450.1 | Rhodococcus rhodochrous |
| 46 | 5651204 | 5651335 | + | NZ_AP022613.1 | Mycobacterium conspicuum |
| 47 | 4385020 | 4385145 | + | NZ_AP022614.1 | Mycobacterium parmense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP012150.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02403.24 | 0.68 | 32 | 2838.0 | same-strand | Seryl-tRNA synthetase N-terminal domain |
| 2 | PF00587.27 | 0.68 | 32 | 2838.0 | same-strand | tRNA synthetase class II core domain (G, H, P, S and T) |
| 3 | PF13845.8 | 0.7 | 33 | 1291 | opposite-strand | Septum formation |
| 4 | PF06262.13 | 0.81 | 38 | 942.0 | opposite-strand | Zincin-like metallopeptidase |
| 5 | PF00300.24 | 1.0 | 47 | -3 | same-strand | Histidine phosphatase superfamily (branch 1) |
| 6 | PF10615.11 | 1.0 | 47 | 944 | opposite-strand | Protein of unknown function (DUF2470) |
| 7 | PF02517.18 | 0.89 | 42 | 1774.5 | opposite-strand | Type II CAAX prenyl endopeptidase Rce1-like |
| 8 | PF03816.16 | 0.89 | 42 | 2904.0 | opposite-strand | LytR cpsA psr family |
| 9 | PF00210.26 | 0.7 | 33 | 3997.0 | opposite-strand | Ferritin-like domain |
| 10 | PF03009.19 | 0.62 | 29 | 4441 | same-strand | Glycerophosphoryl diester phosphodiesterase family |
++ More..