Result : EXP01892
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01892 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 272938 |
| Right | 273030 |
| Strand | - |
| Nucleotide Sequence | GTGCAGGTACGCTCACGCTCAGACACGCCAGGGATATCAGGACACCGAGCCTGCCGGAGAGAAAGCGGGGACTTCGCATCCAGCAGTTCATGA |
| Sequence | VQVRSRSDTPGISGHRACRRESGDFASSSS |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 30 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 285278 | 285370 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 1678787 | 1678879 | - | NZ_CP012150.1 | Mycobacterium goodii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13380.8 | 1.0 | 2 | 4818.0 | same-strand | CoA binding domain |
| 2 | PF01053.22 | 1.0 | 2 | 3529.5 | same-strand | Cys/Met metabolism PLP-dependent enzyme |
| 3 | PF03176.17 | 1.0 | 2 | 0.0 | same-strand | MMPL family |
| 4 | PF16525.7 | 1.0 | 2 | 597.5 | opposite-strand | Haemophore, haem-binding |
| 5 | PF00072.26 | 1.0 | 2 | 1374.0 | opposite-strand | Response regulator receiver domain |
| 6 | PF00486.30 | 1.0 | 2 | 1374.0 | opposite-strand | Transcriptional regulatory protein, C terminal |
| 7 | PF02518.28 | 1.0 | 2 | 2123.0 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 8 | PF00512.27 | 1.0 | 2 | 2123.0 | opposite-strand | His Kinase A (phospho-acceptor) domain |
| 9 | PF00672.27 | 1.0 | 2 | 2123.0 | opposite-strand | HAMP domain |
| 10 | PF11255.10 | 1.0 | 2 | 3461.5 | same-strand | Protein of unknown function (DUF3054) |
++ More..