| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01890 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 1260962 |
| Right | 1261045 |
| Strand | - |
| Nucleotide Sequence | GTGTCCACCTTCACCCCGCGCCGCAGCGCCCACATCATCGGCAGCGCGCAGTCGGTGGCACCGAACGGCAGGTCCGCCGTGTAG |
| Sequence | VSTFTPRRSAHIIGSAQSVAPNGRSAV |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 27 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1286608 | 1286691 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 7015192 | 7015275 | + | NZ_CP012150.1 | Mycobacterium goodii |
| 3 | 1995975 | 1996046 | - | NZ_CP011805.1 | Pelagerythrobacter marensis |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01551.24 | 0.67 | 2 | 1779.0 | same-strand | Peptidase family M23 |