Result : EXP01889

Protein Information

• Protein name: EXP01889
• NCBI Accession ID: CP000480.1
• Organism: Mycolicibacterium smegmatis MC2 155
• Left: 6519879
• Right: 6519962
• Strand: -
• Nucleotide Sequence: GTGAGAGCTCTGCGGTACCGTGGAGTTACGGGTACAGCTATCACGACGTCACAGGAGACAGCACCGTGTATCTCAATCCGCTGA
• Sequence: VRALRYRGVTGTAITTSQETAPCISIR
• Source of smORF: Transcriptional-level
• Pubmed ID: 32181921
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 27

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	6536888	6536971	-	NZ_LN831039.1	Mycolicibacterium smegmatis
2	955795	955878	-	NZ_CP012150.1	Mycobacterium goodii
3	574632	574712	+	NC_009380.1	Salinispora tropica CNB-440

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NZ_LN831039.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00916.22	0.67	2	3185.0	opposite-strand	Sulfate permease family
2	PF01740.23	0.67	2	3185.0	opposite-strand	STAS domain
3	PF00171.24	0.67	2	1842.0	same-strand	Aldehyde dehydrogenase family
4	PF07992.16	0.67	2	441.5	same-strand	Pyridine nucleotide-disulphide oxidoreductase
5	PF14691.8	0.67	2	441.5	same-strand	Dihydroprymidine dehydrogenase domain II, 4Fe-4S cluster
6	PF00310.23	0.67	2	1900.5	same-strand	Glutamine amidotransferases class-II
7	PF01645.19	0.67	2	1900.5	same-strand	Conserved region in glutamate synthase
8	PF04898.16	0.67	2	1900.5	same-strand	Glutamate synthase central domain
9	PF01493.21	0.67	2	1900.5	same-strand	GXGXG motif
10	PF03061.24	0.67	2	7202.5	opposite-strand	Thioesterase superfamily
11	PF00654.22	0.67	2	8034.0	opposite-strand	Voltage gated chloride channel