Result : EXP01884
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01884 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 5179563 |
| Right | 5179640 |
| Strand | - |
| Nucleotide Sequence | GTGCCGGCCCGGATCGCGTTGATGAATCGTGTCATTGGCATGCCGCACGGCAGGCAGACGGATAGGTTTGAGCCATGA |
| Sequence | VPARIALMNRVIGMPHGRQTDRFEP |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5199709 | 5199786 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 3189349 | 3189426 | + | NZ_CP012150.1 | Mycobacterium goodii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00005.29 | 1.0 | 2 | 3761.0 | opposite-strand | ABC transporter |
| 2 | PF04140.16 | 1.0 | 2 | 1507.5 | opposite-strand | Isoprenylcysteine carboxyl methyltransferase (ICMT) family |
| 3 | PF00483.25 | 1.0 | 2 | -3.0 | same-strand | Nucleotidyl transferase |
| 4 | PF13439.8 | 1.0 | 2 | 135.5 | opposite-strand | Glycosyltransferase Family 4 |
| 5 | PF00534.22 | 1.0 | 2 | 135.5 | opposite-strand | Glycosyl transferases group 1 |
| 6 | PF13692.8 | 1.0 | 2 | 135.5 | opposite-strand | Glycosyl transferases group 1 |
| 7 | PF13579.8 | 1.0 | 2 | 135.5 | opposite-strand | Glycosyl transferase 4-like domain |
| 8 | PF13524.8 | 1.0 | 2 | 135.5 | opposite-strand | Glycosyl transferases group 1 |
| 9 | PF03352.15 | 1.0 | 2 | 1659.0 | same-strand | Methyladenine glycosylase |
++ More..