ProsmORF-pred
Result : EXP01884
Protein Information
Information Type Description
Protein name EXP01884
NCBI Accession ID CP000480.1
Organism Mycolicibacterium smegmatis MC2 155
Left 5179563
Right 5179640
Strand -
Nucleotide Sequence GTGCCGGCCCGGATCGCGTTGATGAATCGTGTCATTGGCATGCCGCACGGCAGGCAGACGGATAGGTTTGAGCCATGA
Sequence VPARIALMNRVIGMPHGRQTDRFEP
Source of smORF Transcriptional-level
Function
Pubmed ID 32181921
Domain
Functional Category Function not yet assigned
Uniprot ID
ORF Length (Amino Acid) 25
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 2
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 5199709 5199786 - NZ_LN831039.1 Mycolicibacterium smegmatis
2 3189349 3189426 + NZ_CP012150.1 Mycobacterium goodii
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NZ_LN831039.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF00005.29 1.0 2 3761.0 opposite-strand ABC transporter
2 PF04140.16 1.0 2 1507.5 opposite-strand Isoprenylcysteine carboxyl methyltransferase (ICMT) family
3 PF00483.25 1.0 2 -3.0 same-strand Nucleotidyl transferase
4 PF13439.8 1.0 2 135.5 opposite-strand Glycosyltransferase Family 4
5 PF00534.22 1.0 2 135.5 opposite-strand Glycosyl transferases group 1
6 PF13692.8 1.0 2 135.5 opposite-strand Glycosyl transferases group 1
7 PF13579.8 1.0 2 135.5 opposite-strand Glycosyl transferase 4-like domain
8 PF13524.8 1.0 2 135.5 opposite-strand Glycosyl transferases group 1
9 PF03352.15 1.0 2 1659.0 same-strand Methyladenine glycosylase
++ More..