Result : EXP01881
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01881 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 6952486 |
| Right | 6952557 |
| Strand | - |
| Nucleotide Sequence | GTGACCAGTGCGCCGATTTCGATGCGTGACGTCTGCTCGGCCCACGCCCCGAGCATGGTCCAGCACTCGTAG |
| Sequence | VTSAPISMRDVCSAHAPSMVQHS |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 23 |
++ More..
| Conservation Analysis |
No. of Species: 34
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 6949200 | 6949271 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 6058096 | 6058167 | - | NZ_CP062008.1 | Mycolicibacterium mucogenicum DSM 44124 |
| 3 | 3413056 | 3413127 | - | NZ_AP022577.1 | Mycolicibacterium aubagnense |
| 4 | 1253395 | 1253472 | - | NZ_AP022588.1 | Mycolicibacterium sediminis |
| 5 | 1352826 | 1352897 | - | NZ_CP012150.1 | Mycobacterium goodii |
| 6 | 3799814 | 3799885 | + | NZ_AP022616.1 | Mycolicibacterium phocaicum |
| 7 | 2608182 | 2608259 | + | NZ_AP022567.1 | Mycolicibacterium mageritense |
| 8 | 3599978 | 3600055 | + | NZ_AP022593.1 | Mycolicibacterium arabiense |
| 9 | 3411720 | 3411791 | + | NZ_AP022569.1 | Mycobacterium cookii |
| 10 | 548825 | 548902 | - | NZ_AP022570.1 | Mycolicibacterium poriferae |
| 11 | 41284 | 41361 | + | NZ_CP020809.1 | Mycobacterium dioxanotrophicus |
| 12 | 41015 | 41086 | + | NZ_AP022610.1 | Mycolicibacterium madagascariense |
| 13 | 4831845 | 4831925 | - | NZ_AP024310.1 | Mycobacterium heckeshornense |
| 14 | 1374602 | 1374679 | + | NZ_CP043474.1 | Mycobacterium grossiae |
| 15 | 4955801 | 4955878 | + | NZ_AP022617.1 | Mycolicibacterium monacense |
| 16 | 6217864 | 6217941 | - | NZ_CP011269.1 | Mycolicibacterium fortuitum |
| 17 | 3679306 | 3679383 | + | NZ_AP022565.1 | Mycolicibacterium alvei |
| 18 | 4419707 | 4419778 | + | NZ_AP022586.1 | Mycolicibacterium litorale |
| 19 | 2894936 | 2895010 | + | NZ_LS483468.1 | Rhodococcus coprophilus |
| 20 | 4309211 | 4309282 | + | NZ_AP022608.1 | Mycolicibacterium gadium |
| 21 | 891708 | 891779 | + | NZ_AP022574.1 | Mycolicibacterium psychrotolerans |
| 22 | 4352583 | 4352660 | - | NZ_AP022601.1 | Mycobacterium gallinarum |
| 23 | 1268340 | 1268417 | - | NZ_AP022579.1 | Mycolicibacterium boenickei |
| 24 | 4521841 | 4521918 | + | NZ_LR026975.1 | Mycolicibacterium hassiacum DSM 44199 |
| 25 | 58958 | 59032 | + | NZ_LR130759.1 | Mycobacterium basiliense |
| 26 | 4355250 | 4355321 | + | NC_022657.1 | Actinoplanes friuliensis DSM 7358 |
| 27 | 1859713 | 1859784 | - | NZ_CP015235.1 | Rhodococcus fascians D188 |
| 28 | 2832847 | 2832924 | + | NZ_CP016174.1 | Amycolatopsis orientalis |
| 29 | 3714621 | 3714692 | - | NZ_CP015163.1 | Amycolatopsis albispora |
| 30 | 5842615 | 5842692 | - | NZ_CP008953.1 | Amycolatopsis japonica |
| 31 | 2471954 | 2472031 | + | NC_021252.1 | Amycolatopsis keratiniphila |
| 32 | 431804 | 431875 | - | NZ_AP022560.1 | Mycolicibacterium moriokaense |
| 33 | 1907177 | 1907248 | - | NZ_CP031305.1 | Natronorubrum bangense |
| 34 | 2150992 | 2151069 | - | NZ_CP032630.1 | Protaetiibacter intestinalis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01658.19 | 0.65 | 22 | 3500.5 | opposite-strand | Myo-inositol-1-phosphate synthase |
| 2 | PF12697.9 | 0.74 | 25 | 2376 | opposite-strand | Alpha/beta hydrolase family |
| 3 | PF12146.10 | 0.68 | 23 | 2385 | opposite-strand | Serine aminopeptidase, S33 |
| 4 | PF00497.22 | 0.71 | 24 | 1351.0 | opposite-strand | Bacterial extracellular solute-binding proteins, family 3 |
| 5 | PF00528.24 | 0.71 | 24 | 1357.5 | opposite-strand | Binding-protein-dependent transport system inner membrane component |
| 6 | PF00005.29 | 0.76 | 26 | 3065.5 | opposite-strand | ABC transporter |
| 7 | PF01047.24 | 0.74 | 25 | 3913 | opposite-strand | MarR family |
| 8 | PF12802.9 | 0.74 | 25 | 3913 | opposite-strand | MarR family |
++ More..