Result : EXP01878
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01878 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 6352828 |
| Right | 6352896 |
| Strand | - |
| Nucleotide Sequence | GTGAACTCCCCCAGGGCCGGAAGGCAGCAAGGGTCAACGGGCTCTGGCGGGTGCGCGGGGTCCCCTTGA |
| Sequence | VNSPRAGRQQGSTGSGGCAGSP |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 29
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3174535 | 3174609 | + | NZ_AP022567.1 | Mycolicibacterium mageritense |
| 2 | 1948955 | 1949023 | + | NZ_AP022598.1 | Mycolicibacterium parafortuitum |
| 3 | 764292 | 764360 | - | NZ_CP012150.1 | Mycobacterium goodii |
| 4 | 6359683 | 6359751 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 5 | 4870175 | 4870243 | + | NZ_AP022586.1 | Mycolicibacterium litorale |
| 6 | 267439 | 267507 | + | NZ_CP018082.1 | Nocardia mangyaensis |
| 7 | 345632 | 345703 | + | NZ_AP022561.1 | Mycolicibacterium aichiense |
| 8 | 282166 | 282234 | + | NC_006361.1 | Nocardia farcinica IFM 10152 |
| 9 | 908372 | 908440 | + | NZ_AP022560.1 | Mycolicibacterium moriokaense |
| 10 | 2764159 | 2764230 | + | NZ_AP022596.1 | Mycolicibacterium helvum |
| 11 | 5270278 | 5270358 | - | NZ_AP022610.1 | Mycolicibacterium madagascariense |
| 12 | 254993 | 255061 | + | NZ_AP023396.1 | Nocardia wallacei |
| 13 | 4040538 | 4040609 | + | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 14 | 2412016 | 2412093 | + | NZ_CP015235.1 | Rhodococcus fascians D188 |
| 15 | 4985748 | 4985819 | - | NZ_AP018164.1 | Mycobacterium shigaense |
| 16 | 919444 | 919512 | + | NZ_CP022208.1 | Rhodococcus pyridinivorans |
| 17 | 5506624 | 5506692 | - | NZ_AP022613.1 | Mycobacterium conspicuum |
| 18 | 375376 | 375444 | + | NZ_LT906450.1 | Rhodococcus rhodochrous |
| 19 | 2573290 | 2573358 | - | NZ_LS483468.1 | Rhodococcus coprophilus |
| 20 | 387173 | 387241 | + | NZ_CP011853.1 | Gordonia phthalatica |
| 21 | 145185 | 145265 | + | NC_017301.2 | Corynebacterium pseudotuberculosis C231 |
| 22 | 268154 | 268222 | + | NZ_CP004353.1 | Corynebacterium vitaeruminis DSM 20294 |
| 23 | 220080 | 220148 | + | NC_004369.1 | Corynebacterium efficiens YS-314 |
| 24 | 189718 | 189792 | + | NZ_CP006841.1 | Corynebacterium lactis RW2-5 |
| 25 | 235777 | 235845 | + | NZ_LR738855.1 | Corynebacterium rouxii |
| 26 | 225873 | 225941 | + | NZ_CP011541.1 | Corynebacterium epidermidicanis |
| 27 | 1368816 | 1368893 | + | NZ_CP007519.1 | Trueperella pyogenes |
| 28 | 250184 | 250252 | - | NZ_LT906467.1 | Corynebacterium imitans |
| 29 | 259440 | 259508 | + | NZ_CP015622.1 | Corynebacterium crudilactis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_AP022567.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12897.9 | 0.97 | 28 | 60.5 | same-strand | Aspartate amino-transferase |
| 2 | PF13177.8 | 0.76 | 22 | 1565.5 | same-strand | DNA polymerase III, delta subunit |
| 3 | PF12169.10 | 0.76 | 22 | 1565.5 | same-strand | DNA polymerase III subunits gamma and tau domain III |
| 4 | PF00004.31 | 0.76 | 22 | 1565.5 | same-strand | ATPase family associated with various cellular activities (AAA) |
| 5 | PF13401.8 | 0.76 | 22 | 1565.5 | same-strand | AAA domain |
++ More..