Result : EXP01875
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01875 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 2183072 |
| Right | 2183134 |
| Strand | - |
| Nucleotide Sequence | GTGACGATAGTGATCACTGAGGCGTTTGTGCCCCGTGAGTCATCAATAGCGACCCATCCGTGA |
| Sequence | VTIVITEAFVPRESSIATHP |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 6127775 | 6127837 | + | NZ_CP012150.1 | Mycobacterium goodii |
| 2 | 2255787 | 2255849 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP012150.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF11209.10 | 1.0 | 2 | 3841.5 | opposite-strand | LmeA-like phospholipid-binding |
| 2 | PF13810.8 | 1.0 | 2 | 51.5 | opposite-strand | Domain of unknown function (DUF4185) |
++ More..