Result : EXP01871
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01871 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 2551193 |
| Right | 2551252 |
| Strand | - |
| Nucleotide Sequence | GTGAACGCATCGTCAGGCCGTGCACCCCGAGCGCGGGATCGATCCCGTACAGATCGGTGA |
| Sequence | VNASSGRAPRARDRSRTDR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2619097 | 2619156 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 5819158 | 5819217 | + | NZ_CP012150.1 | Mycobacterium goodii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01979.22 | 1.0 | 2 | 5235.0 | opposite-strand | Amidohydrolase family |
| 2 | PF02771.18 | 1.0 | 2 | 4004.5 | opposite-strand | Acyl-CoA dehydrogenase, N-terminal domain |
| 3 | PF00441.26 | 1.0 | 2 | 4004.5 | opposite-strand | Acyl-CoA dehydrogenase, C-terminal domain |
| 4 | PF02770.21 | 1.0 | 2 | 4004.5 | opposite-strand | Acyl-CoA dehydrogenase, middle domain |
| 5 | PF08028.13 | 1.0 | 2 | 4004.5 | opposite-strand | Acyl-CoA dehydrogenase, C-terminal domain |
| 6 | PF00676.22 | 1.0 | 2 | 1798.0 | opposite-strand | Dehydrogenase E1 component |
| 7 | PF02779.26 | 1.0 | 2 | 1798.0 | opposite-strand | Transketolase, pyrimidine binding domain |
| 8 | PF02780.22 | 1.0 | 2 | 1798.0 | opposite-strand | Transketolase, C-terminal domain |
| 9 | PF02515.19 | 1.0 | 2 | 544.0 | opposite-strand | CoA-transferase family III |
| 10 | PF13622.8 | 1.0 | 2 | -59.0 | opposite-strand | Thioesterase-like superfamily |
| 11 | PF01037.23 | 1.0 | 2 | 4006.5 | opposite-strand | Lrp/AsnC ligand binding domain |
| 12 | PF13404.8 | 1.0 | 2 | 4006.5 | opposite-strand | AsnC-type helix-turn-helix domain |
| 13 | PF13412.8 | 1.0 | 2 | 4006.5 | opposite-strand | Winged helix-turn-helix DNA-binding |
| 14 | PF09339.12 | 1.0 | 2 | 4006.5 | opposite-strand | IclR helix-turn-helix domain |
++ More..