Result : EXP01868
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01868 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 2035866 |
| Right | 2035922 |
| Strand | - |
| Nucleotide Sequence | GTGACCCGCCCCCGTACGCGGCTTCGATGTCATGAGTACGGTTGCAGGTATGGCTGA |
| Sequence | VTRPRTRLRCHEYGCRYG |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2103349 | 2103405 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 6247691 | 6247747 | + | NZ_CP012150.1 | Mycobacterium goodii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF10103.11 | 1.0 | 2 | -16.0 | same-strand | Zincin-like metallopeptidase |
| 2 | PF03699.15 | 1.0 | 2 | 1204.0 | opposite-strand | Uncharacterised protein family (UPF0182) |
++ More..