Result : EXP01867
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01867 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 4782404 |
| Right | 4782457 |
| Strand | - |
| Nucleotide Sequence | GTGAGCAGGATCTGGCGACCCTGTCGGTTGCGGCACGTCAGATCCGCAGCATGA |
| Sequence | VSRIWRPCRLRHVRSAA |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4793123 | 4793176 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 3620448 | 3620501 | + | NZ_CP012150.1 | Mycobacterium goodii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01152.23 | 1.0 | 2 | 2699.5 | opposite-strand | Bacterial-like globin |
| 2 | PF00128.26 | 1.0 | 2 | 1161.5 | opposite-strand | Alpha amylase, catalytic domain |
| 3 | PF13279.8 | 1.0 | 2 | 62.0 | same-strand | Thioesterase-like superfamily |
| 4 | PF05088.14 | 1.0 | 2 | -53.0 | same-strand | Bacterial NAD-glutamate dehydrogenase |
| 5 | PF00005.29 | 1.0 | 2 | 4867.0 | same-strand | ABC transporter |
| 6 | PF12848.9 | 1.0 | 2 | 4867.0 | same-strand | ABC transporter |
| 7 | PF00436.27 | 1.0 | 2 | 6648.0 | same-strand | Single-strand binding protein family |
| 8 | PF09678.12 | 1.0 | 2 | 7443.5 | same-strand | Cytochrome c oxidase caa3 assembly factor (Caa3 CtaG) |
| 9 | PF05425.15 | 1.0 | 2 | 7443.5 | same-strand | Copper resistance protein D |
| 10 | PF19277.1 | 1.0 | 2 | 9527.0 | same-strand | Glycerol-3-phosphate acyltransferase C-terminal region |
| 11 | PF01553.23 | 1.0 | 2 | 9546 | same-strand | Acyltransferase |
++ More..