Result : EXP01864
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01864 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 2012517 |
| Right | 2012567 |
| Strand | - |
| Nucleotide Sequence | ATGAGCCACTGGGCGAACATGCCCCAAGTGCGCCAGAGCAATACAGATTGA |
| Sequence | MSHWANMPQVRQSNTD |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 6277686 | 6277736 | + | NZ_CP012150.1 | Mycobacterium goodii |
| 2 | 2078503 | 2078553 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP012150.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12697.9 | 1.0 | 2 | 3822.0 | same-strand | Alpha/beta hydrolase family |
| 2 | PF01035.22 | 1.0 | 2 | 3523.5 | same-strand | 6-O-methylguanine DNA methyltransferase, DNA binding domain |
| 3 | PF00899.23 | 1.0 | 2 | 1364.0 | opposite-strand | ThiF family |
| 4 | PF00581.22 | 1.0 | 2 | 1364.0 | opposite-strand | Rhodanese-like domain |
| 5 | PF11350.10 | 1.0 | 2 | -19.0 | opposite-strand | Protein of unknown function (DUF3152) |
| 6 | PF00440.25 | 1.0 | 2 | 8.0 | same-strand | Bacterial regulatory proteins, tetR family |
| 7 | PF19344.1 | 1.0 | 2 | 8.0 | same-strand | Tetracyclin repressor-like, C-terminal domain |
| 8 | PF11305.10 | 1.0 | 2 | 676.5 | opposite-strand | Protein of unknown function (DUF3107) |
| 9 | PF13794.8 | 1.0 | 2 | 2077.0 | opposite-strand | tRNA-(MS[2]IO[6]A)-hydroxylase (MiaE)-like |
| 10 | PF00270.31 | 1.0 | 2 | 3081.5 | same-strand | DEAD/DEAH box helicase |
| 11 | PF00271.33 | 1.0 | 2 | 3081.5 | same-strand | Helicase conserved C-terminal domain |
++ More..