Result : EXP01863
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01863 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 4873535 |
| Right | 4873582 |
| Strand | - |
| Nucleotide Sequence | ATGTGGAGTTTCTCGAAGAGCTACCCCTCAATGCCACGGGCAAGGTGA |
| Sequence | MWSFSKSYPSMPRAR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4884133 | 4884180 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 3531975 | 3532025 | + | NZ_CP012150.1 | Mycobacterium goodii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00501.30 | 1.0 | 2 | 1298.0 | same-strand | AMP-binding enzyme |
| 2 | PF13193.8 | 1.0 | 2 | 1298.0 | same-strand | AMP-binding enzyme C-terminal domain |
| 3 | PF04909.16 | 1.0 | 2 | 1432.0 | same-strand | Amidohydrolase |
| 4 | PF01796.19 | 1.0 | 2 | 5386.0 | opposite-strand | DUF35 OB-fold domain, acyl-CoA-associated |
++ More..