Result : EXP01858
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01858 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 2949383 |
| Right | 2949427 |
| Strand | - |
| Nucleotide Sequence | GTGCGGTCGAACGTGTCCATCGGCATGTCCTCGATGATCGAGTAG |
| Sequence | VRSNVSIGMSSMIE |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3012681 | 3012725 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 3057143 | 3057187 | - | NC_008726.1 | Mycolicibacterium vanbaalenii PYR-1 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00501.30 | 1.0 | 2 | 2371.0 | same-strand | AMP-binding enzyme |
| 2 | PF13193.8 | 1.0 | 2 | 2371.0 | same-strand | AMP-binding enzyme C-terminal domain |
| 3 | PF13450.8 | 1.0 | 2 | 329.0 | opposite-strand | NAD(P)-binding Rossmann-like domain |
| 4 | PF00106.27 | 1.0 | 2 | -44.0 | opposite-strand | short chain dehydrogenase |
| 5 | PF07876.14 | 1.0 | 2 | 518.5 | same-strand | Stress responsive A/B Barrel Domain |
| 6 | PF07859.15 | 1.0 | 2 | 2794.5 | same-strand | alpha/beta hydrolase fold |
| 7 | PF01614.20 | 1.0 | 2 | 3740.0 | same-strand | Bacterial transcriptional regulator |
| 8 | PF09339.12 | 1.0 | 2 | 3740.0 | same-strand | IclR helix-turn-helix domain |
++ More..