Result : EXP01854
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01854 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 5075282 |
| Right | 5075326 |
| Strand | - |
| Nucleotide Sequence | ATGCTTACAATCCTGGCCAGTTCTACCAACTTAATGGGGAAGTAG |
| Sequence | MLTILASSTNLMGK |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5095422 | 5095466 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 3296054 | 3296098 | + | NZ_CP012150.1 | Mycobacterium goodii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12900.9 | 1.0 | 2 | 4158.0 | same-strand | Pyridoxamine 5'-phosphate oxidase |
| 2 | PF00857.22 | 1.0 | 2 | 3565.0 | same-strand | Isochorismatase family |
| 3 | PF00459.27 | 1.0 | 2 | 2781.5 | same-strand | Inositol monophosphatase family |
| 4 | PF01583.22 | 1.0 | 2 | 936.0 | same-strand | Adenylylsulphate kinase |
| 5 | PF00009.29 | 1.0 | 2 | 936.0 | same-strand | Elongation factor Tu GTP binding domain |
| 6 | PF01926.25 | 1.0 | 2 | 936.0 | same-strand | 50S ribosome-binding GTPase |
| 7 | PF03144.27 | 1.0 | 2 | 936.0 | same-strand | Elongation factor Tu domain 2 |
| 8 | PF01507.21 | 1.0 | 2 | 1.0 | same-strand | Phosphoadenosine phosphosulfate reductase family |
| 9 | PF07690.18 | 1.0 | 2 | 70.5 | same-strand | Major Facilitator Superfamily |
| 10 | PF03061.24 | 1.0 | 2 | 2940.0 | opposite-strand | Thioesterase superfamily |
| 11 | PF14539.8 | 1.0 | 2 | 2940.0 | opposite-strand | Domain of unknown function (DUF4442) |
++ More..