Result : EXP01852
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01852 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 5228423 |
| Right | 5228464 |
| Strand | - |
| Nucleotide Sequence | ATGCCAGGCGTAGTAGATCCAGAATGTGAGACGCGTGGATGA |
| Sequence | MPGVVDPECETRG |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 13 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3143696 | 3143737 | + | NZ_CP012150.1 | Mycobacterium goodii |
| 2 | 5241367 | 5241408 | - | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 3 | 5105627 | 5105668 | + | NZ_AP022565.1 | Mycolicibacterium alvei |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP012150.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00496.24 | 0.67 | 2 | 2817.0 | same-strand | Bacterial extracellular solute-binding proteins, family 5 Middle |
| 2 | PF02585.19 | 1.0 | 3 | 1962 | same-strand | GlcNAc-PI de-N-acetylase |
| 3 | PF04055.23 | 1.0 | 3 | 29 | same-strand | Radical SAM superfamily |
| 4 | PF04264.15 | 1.0 | 3 | 2873 | same-strand | YceI-like domain |
| 5 | PF00724.22 | 0.67 | 2 | 3545.0 | opposite-strand | NADH:flavin oxidoreductase / NADH oxidase family |
| 6 | PF07992.16 | 0.67 | 2 | 3545.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 7 | PF00037.29 | 1.0 | 3 | 6358 | same-strand | 4Fe-4S binding domain |
| 8 | PF12838.9 | 1.0 | 3 | 6358 | same-strand | 4Fe-4S dicluster domain |
| 9 | PF13187.8 | 1.0 | 3 | 6358 | same-strand | 4Fe-4S dicluster domain |
| 10 | PF12800.9 | 1.0 | 3 | 6358 | same-strand | 4Fe-4S binding domain |
++ More..