Result : EXP01847

Protein Information

• Protein name: EXP01847
• NCBI Accession ID: CP000480.1
• Organism: Mycolicibacterium smegmatis MC2 155
• Left: 5375958
• Right: 5376104
• Strand: +
• Nucleotide Sequence: GTGCGGTGCTGCGACTGCTGGACCCGTCGCTGTCGGCAGCGGGGATCCTGCGGGCCGAGAAGATCCTCGACGCGGTGCGCGACATCCTCGGAGACGTCACCATCGAGGAGTTGCCCATCCCTTACACCGCGGTCGCGACCGATCTGA
• Sequence: VRCCDCWTRRCRQRGSCGPRRSSTRCATSSETSPSRSCPSLTPRSRPI
• Source of smORF: Transcriptional-level
• Pubmed ID: 32181921
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 48

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	5385934	5386080	+	NZ_LN831039.1	Mycolicibacterium smegmatis
2	1690973	1691119	-	NZ_CP020809.1	Mycobacterium dioxanotrophicus

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NZ_LN831039.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF17301.4	1.0	2	3144.0	same-strand	Putative lipoprotein LpqV
2	PF01734.24	1.0	2	241.0	both-strands	Patatin-like phospholipase
3	PF08240.14	1.0	2	2082.5	same-strand	Alcohol dehydrogenase GroES-like domain
4	PF00107.28	1.0	2	2082.5	same-strand	Zinc-binding dehydrogenase
5	PF13602.8	1.0	2	2082.5	same-strand	Zinc-binding dehydrogenase
6	PF19328.1	1.0	2	3076.5	opposite-strand	2,4-diaminopentanoate dehydrogenase C-terminal domain