Result : EXP01845
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01845 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 5650281 |
| Right | 5650424 |
| Strand | + |
| Nucleotide Sequence | GTGGCAGCGCCTGCAGGCCGCGTGCGCGCGCCACCAGGTCGAGTGGTTCTGGGTGAAGGGGCACTCGGGCATCGGCGACAACGAGCTGGCCGACGAACTCGCGACCCGCGGACTGCAGGAGGCAGTGGGCCTCACCACCAGTAG |
| Sequence | VAAPAGRVRAPPGRVVLGEGALGHRRQRAGRRTRDPRTAGGSGPHHQ |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 47 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5657216 | 5657359 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 2725884 | 2726027 | - | NZ_CP012150.1 | Mycobacterium goodii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00083.26 | 1.0 | 2 | 714.0 | same-strand | Sugar (and other) transporter |
| 2 | PF00075.26 | 1.0 | 2 | -143.0 | same-strand | RNase H |
| 3 | PF04982.15 | 1.0 | 2 | -12.0 | opposite-strand | HPP family |
| 4 | PF12833.9 | 1.0 | 2 | 1307.0 | opposite-strand | Helix-turn-helix domain |
| 5 | PF00165.25 | 1.0 | 2 | 1307.0 | opposite-strand | Bacterial regulatory helix-turn-helix proteins, AraC family |
| 6 | PF01965.26 | 1.0 | 2 | 1307.0 | opposite-strand | DJ-1/PfpI family |
++ More..