Result : EXP01834
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01834 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 2432524 |
| Right | 2432634 |
| Strand | + |
| Nucleotide Sequence | ATGGCAGGCCGGTCCCCGGCCTCATCGAGGAGGACGAACCAGAGTCATGACGAACATCGTGGTCCTGATCAAACAGGTCCCAGACACATGGTCCGAGCGCAAGCTCTCTGA |
| Sequence | MAGRSPASSRRTNQSHDEHRGPDQTGPRHMVRAQAL |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 36 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2500386 | 2500496 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 5951036 | 5951146 | - | NZ_CP012150.1 | Mycobacterium goodii |
| 3 | 2239932 | 2240027 | + | NC_008726.1 | Mycolicibacterium vanbaalenii PYR-1 |
| 4 | 2050673 | 2050768 | + | NZ_LR134356.1 | Mycolicibacterium aurum |
| 5 | 435362 | 435478 | - | NZ_AP022599.1 | Mycolicibacterium pulveris |
| 6 | 933622 | 933750 | - | NZ_AP022568.1 | Mycobacterium simiae |
| 7 | 2311841 | 2311954 | - | NZ_AP022609.1 | Mycolicibacter hiberniae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP012150.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00534.22 | 1.0 | 7 | 2581 | opposite-strand | Glycosyl transferases group 1 |
| 2 | PF13692.8 | 1.0 | 7 | 2581 | opposite-strand | Glycosyl transferases group 1 |
| 3 | PF13439.8 | 1.0 | 7 | 2581 | opposite-strand | Glycosyltransferase Family 4 |
| 4 | PF13579.8 | 1.0 | 7 | 2581 | opposite-strand | Glycosyl transferase 4-like domain |
| 5 | PF08323.13 | 1.0 | 7 | 2581 | opposite-strand | Starch synthase catalytic domain |
| 6 | PF13524.8 | 1.0 | 7 | 2581 | opposite-strand | Glycosyl transferases group 1 |
| 7 | PF08241.14 | 1.0 | 7 | 171 | opposite-strand | Methyltransferase domain |
| 8 | PF13649.8 | 1.0 | 7 | 171 | opposite-strand | Methyltransferase domain |
| 9 | PF13489.8 | 0.86 | 6 | 166.0 | opposite-strand | Methyltransferase domain |
| 10 | PF08242.14 | 1.0 | 7 | 171 | opposite-strand | Methyltransferase domain |
| 11 | PF01012.23 | 1.0 | 7 | 348.5 | same-strand | Electron transfer flavoprotein domain |
| 12 | PF00766.21 | 1.0 | 7 | 784 | same-strand | Electron transfer flavoprotein FAD-binding domain |
| 13 | PF13460.8 | 0.71 | 5 | 1916 | same-strand | NAD(P)H-binding |
| 14 | PF13444.8 | 0.86 | 6 | 3038.0 | same-strand | Acetyltransferase (GNAT) domain |
| 15 | PF03065.17 | 0.71 | 5 | 954 | opposite-strand | Glycosyl hydrolase family 57 |
++ More..