ProsmORF-pred
Result : EXP01831
Protein Information
Information Type Description
Protein name EXP01831
NCBI Accession ID CP000480.1
Organism Mycolicibacterium smegmatis MC2 155
Left 5860943
Right 5861041
Strand +
Nucleotide Sequence GTGGTGCTCTTCTTCGAGATCCTGCTTGTCGCGGCCGTGCTGGTCATCACGTGGTTCGCGGTGTACGCGCTGTACCGTCTGGTCACCGACGAGTCGTGA
Sequence VVLFFEILLVAAVLVITWFAVYALYRLVTDES
Source of smORF Transcriptional-level
Function
Pubmed ID 32181921
Domain
Functional Category Function not yet assigned
Uniprot ID
ORF Length (Amino Acid) 32
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 121
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 3827985 3828083 + NZ_LR026975.1 Mycolicibacterium hassiacum DSM 44199
2 4365499 4365597 + NZ_AP022618.1 Mycolicibacterium insubricum
3 4143510 4143608 + NZ_LT906483.1 Mycolicibacterium thermoresistibile
4 895584 895682 + NZ_AP022595.1 Mycolicibacterium sarraceniae
5 160106 160204 - NZ_AP022581.1 Mycobacterium lacus
6 2495549 2495647 - NZ_CP012150.1 Mycobacterium goodii
7 5879063 5879161 + NZ_LN831039.1 Mycolicibacterium smegmatis
8 5118856 5118954 + NZ_LR134356.1 Mycolicibacterium aurum
9 1280036 1280134 + NZ_AP022567.1 Mycolicibacterium mageritense
10 854485 854583 - NZ_CP011530.1 Mycobacteroides immunogenum
11 720229 720327 - NZ_CP014955.1 Mycobacteroides abscessus
12 683051 683149 - NZ_AP018165.1 [Mycobacterium] stephanolepidis
13 645251 645349 - NZ_CP024633.1 Mycobacteroides salmoniphilum
14 355613 355711 - NZ_AP022612.1 Mycolicibacterium confluentis
15 3177638 3177736 + NZ_AP022616.1 Mycolicibacterium phocaicum
16 2258674 2258772 - NZ_AP022579.1 Mycolicibacterium boenickei
17 1108971 1109069 - NZ_CP011269.1 Mycolicibacterium fortuitum
18 3291638 3291736 - NZ_AP022568.1 Mycobacterium simiae
19 2141782 2141880 - NZ_AP022606.1 Mycobacterium branderi
20 2388556 2388654 - NZ_AP022598.1 Mycolicibacterium parafortuitum
21 5469057 5469155 + NC_008726.1 Mycolicibacterium vanbaalenii PYR-1
22 3657422 3657520 - NZ_AP022603.1 Mycolicibacterium fallax
23 3094014 3094112 - NZ_AP022599.1 Mycolicibacterium pulveris
24 2532774 2532872 - NZ_AP022600.1 Mycolicibacterium tokaiense
25 6284690 6284788 + NZ_CP020809.1 Mycobacterium dioxanotrophicus
26 705667 705765 - NZ_LR134355.1 Mycolicibacterium chitae
27 4431855 4431953 - NZ_AP022576.1 Mycobacterium florentinum
28 2690621 2690719 + NZ_AP022569.1 Mycobacterium cookii
29 691157 691255 - NZ_CP007220.1 Mycobacteroides chelonae CCUG 47445
30 3718215 3718313 + NZ_AP022601.1 Mycobacterium gallinarum
31 3597548 3597646 + NZ_AP022608.1 Mycolicibacterium gadium
32 5163374 5163472 + NZ_CP011491.1 Mycolicibacterium vaccae 95051
33 4072042 4072140 - NZ_AP022577.1 Mycolicibacterium aubagnense
34 646781 646879 - NZ_CP010271.1 Mycobacteroides saopaulense
35 3376352 3376450 + NZ_AP022619.1 Mycobacterium paraseoulense
36 1776385 1776483 - NZ_AP022574.1 Mycolicibacterium psychrotolerans
37 4595406 4595504 - NZ_AP022565.1 Mycolicibacterium alvei
38 569116 569214 - NZ_CP062008.1 Mycolicibacterium mucogenicum DSM 44124
39 5296778 5296876 - NZ_AP022563.1 Mycolicibacterium duvalii
40 659614 659712 - NZ_CP009360.4 Mycobacterium avium subsp. hominissuis
41 4408900 4408998 - NZ_AP022575.1 Mycobacterium shinjukuense
42 4700366 4700464 - NZ_AP022587.1 Mycobacterium stomatepiae
43 3544123 3544221 + NZ_AP022582.1 Mycobacterium seoulense
44 2389469 2389567 + NC_022663.1 Mycobacterium kansasii ATCC 12478
45 3600285 3600383 + NZ_CP011883.2 Mycobacterium haemophilum DSM 44634
46 3129430 3129528 - NZ_AP022596.1 Mycolicibacterium helvum
47 732643 732741 - NZ_AP022561.1 Mycolicibacterium aichiense
48 639301 639399 - NZ_CP023147.1 Mycobacterium marseillense
49 5827922 5828020 - NZ_AP022617.1 Mycolicibacterium monacense
50 2548476 2548574 + NZ_CP029543.1 Mycobacterium leprae
51 4923358 4923456 + NZ_AP022610.1 Mycolicibacterium madagascariense
52 3285796 3285894 + NZ_AP022620.1 Mycolicibacterium anyangense
53 4235669 4235767 + NC_013441.1 Gordonia bronchialis DSM 43247
54 1395078 1395176 - NZ_AP022560.1 Mycolicibacterium moriokaense
55 49802 49897 + NZ_AP022588.1 Mycolicibacterium sediminis
56 665481 665579 - NC_016948.1 Mycobacterium paraintracellulare
57 656805 656903 - NC_016946.1 Mycobacterium intracellulare ATCC 13950
58 2890047 2890145 + NZ_AP022573.1 Mycobacterium saskatchewanense
59 3236310 3236408 + NZ_AP022605.1 Mycobacterium doricum
60 1995795 1995893 - NZ_AP022572.1 Mycobacterium shottsii
61 2768064 2768174 + NZ_LT906450.1 Rhodococcus rhodochrous
62 850435 850533 - NZ_LT906450.1 Rhodococcus rhodochrous
63 3090673 3090783 + NZ_CP022208.1 Rhodococcus pyridinivorans
64 1353090 1353188 - NZ_CP022208.1 Rhodococcus pyridinivorans
65 306221 306334 - NZ_CP022208.1 Rhodococcus pyridinivorans
66 5968465 5968563 + NZ_CP025546.1 Mycobacterium paragordonae
67 723899 723997 + NZ_CP058277.1 Mycobacterium marinum
68 5460668 5460766 + NZ_AP018410.1 Mycobacterium pseudoshottsii JCM 15466
69 1105656 1105754 + NZ_AP022589.1 Mycolicibacter minnesotensis
70 4965033 4965131 - NZ_AP022614.1 Mycobacterium parmense
71 5281365 5281463 - NZ_AP022586.1 Mycolicibacterium litorale
72 915727 915825 - NC_015848.1 Mycobacterium canettii CIPT 140010059
73 908015 908113 - NC_000962.3 Mycobacterium tuberculosis H37Rv
74 5122153 5122251 + NZ_AP022613.1 Mycobacterium conspicuum
75 5316166 5316264 - NZ_AP022590.1 Mycobacterium mantenii
76 2781265 2781363 - NZ_AP022615.1 Mycobacterium heidelbergense
77 974721 974819 - NZ_CP027433.1 Gordonia iterans
78 4638943 4639041 + NZ_AP018164.1 Mycobacterium shigaense
79 201590 201688 + NZ_CP059694.1 Gordonia rubripertincta
80 693392 693490 - NZ_AP024310.1 Mycobacterium heckeshornense
81 1817005 1817103 - NZ_CP027114.1 Gordonia alkanivorans
82 1136729 1136827 + NZ_AP022583.1 Mycobacterium noviomagense
83 4864948 4865046 + NZ_LR130759.1 Mycobacterium basiliense
84 3752016 3752114 + NC_015576.1 Mycolicibacter sinensis
85 3713894 3713992 + NZ_LT906469.1 Mycolicibacter terrae
86 2733565 2733663 - NZ_AP022562.1 Mycobacterium novum
87 3077180 3077278 + NZ_AP022609.1 Mycolicibacter hiberniae
88 346231 346329 - NZ_CP048813.1 Rhodococcus triatomae
89 5456317 5456415 + NZ_AP022570.1 Mycolicibacterium poriferae
90 751793 751891 - NZ_CP011853.1 Gordonia phthalatica
91 399193 399291 + NZ_CP043474.1 Mycobacterium grossiae
92 4714372 4714470 - NZ_AP022593.1 Mycolicibacterium arabiense
93 951084 951182 - NZ_CP029146.1 Rhodococcus ruber
94 2098228 2098326 + NZ_LS483468.1 Rhodococcus coprophilus
95 1982200 1982310 - NZ_LS483468.1 Rhodococcus coprophilus
96 608174 608269 - NZ_CP018082.1 Nocardia mangyaensis
97 986134 986232 - NZ_CP027793.1 Rhodococcus hoagii
98 4629488 4629586 + NC_016906.1 Gordonia polyisoprenivorans VH2
99 5031624 5031722 + NZ_AP023172.1 Rhodococcus qingshengii
100 835367 835465 - NZ_CP015453.1 Dietzia psychralcaliphila
101 1037131 1037226 + NZ_CP026746.1 Nocardia cyriacigeorgica
102 891553 891651 - NZ_CP015449.1 Dietzia lutea
103 1407832 1407927 - NZ_LR134352.1 Nocardia asteroides
104 5824649 5824744 + NZ_CP022088.2 Nocardia brasiliensis
105 646973 647068 - NZ_AP023396.1 Nocardia wallacei
106 2519402 2519500 + NZ_CP033972.1 Gordonia insulae
107 6268327 6268422 + NZ_CP041695.1 Nocardia otitidiscaviarum
108 778222 778326 - NC_015564.1 Hoyosella subflava DQS3-9A1
109 9875955 9876053 + NC_022116.1 Amycolatopsis mediterranei RB
110 5571419 5571517 + NC_013235.1 Nakamurella multipartita DSM 44233
111 7417433 7417534 + NZ_AP017900.1 Nocardia seriolae
112 8573803 8573901 + NC_021252.1 Amycolatopsis keratiniphila
113 849206 849304 - NZ_CP015961.1 Dietzia timorensis
114 9535840 9535938 + NZ_CP007155.1 Kutzneria albida DSM 43870
115 8582483 8582581 + NZ_CP008953.1 Amycolatopsis japonica
116 379439 379537 - NZ_CP016174.1 Amycolatopsis orientalis
117 415981 416088 + NZ_CP039291.1 Cellulomonas shaoxiangyii
118 829241 829339 + NZ_CP015235.1 Rhodococcus fascians D188
119 612839 612934 - NC_006361.1 Nocardia farcinica IFM 10152
120 7855465 7855563 + NZ_CP023445.1 Actinosynnema pretiosum
121 6860646 6860744 - NZ_CP015163.1 Amycolatopsis albispora
122 7969777 7969875 + NC_013093.1 Actinosynnema mirum DSM 43827
123 6852506 6852604 + NZ_CP016076.1 Actinoalloteichus fjordicus
124 6348893 6348991 + NZ_CP022521.1 Actinoalloteichus hoggarensis
125 3435031 3435138 - NC_014151.1 Cellulomonas flavigena DSM 20109
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NZ_LR026975.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF11209.10 0.83 101 2370 same-strand LmeA-like phospholipid-binding
2 PF14340.8 0.76 92 1264.0 same-strand Domain of unknown function (DUF4395)
3 PF00581.22 0.9 109 410 same-strand Rhodanese-like domain
4 PF07210.14 0.9 109 101 same-strand Protein of unknown function (DUF1416)
5 PF08768.13 1.0 121 -3 same-strand THAP4-like, heme-binding beta-barrel domain
6 PF01063.21 0.69 83 1469 opposite-strand Amino-transferase class IV
++ More..