Result : EXP01828
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01828 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 4532688 |
| Right | 4532780 |
| Strand | + |
| Nucleotide Sequence | GTGCGACGCGATCAGCGGTACATGACGCGCGGCCGCATCCACGCCGAAGTCGCCGATTTGCTCGACCGGACGGTCGCTATGAACGGTGAATAA |
| Sequence | VRRDQRYMTRGRIHAEVADLLDRTVAMNGE |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 30 |
++ More..
| Conservation Analysis |
No. of Species: 9
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4532761 | 4532853 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 3955899 | 3955988 | - | NZ_AP022615.1 | Mycobacterium heidelbergense |
| 3 | 5711437 | 5711526 | + | NZ_CP058277.1 | Mycobacterium marinum |
| 4 | 1528604 | 1528693 | + | NZ_AP022573.1 | Mycobacterium saskatchewanense |
| 5 | 3658769 | 3658852 | + | NZ_CP022208.1 | Rhodococcus pyridinivorans |
| 6 | 3268102 | 3268191 | - | NZ_AP022572.1 | Mycobacterium shottsii |
| 7 | 6258182 | 6258271 | + | NZ_CP020809.1 | Mycobacterium dioxanotrophicus |
| 8 | 1415750 | 1415839 | - | NZ_AP022560.1 | Mycolicibacterium moriokaense |
| 9 | 4897006 | 4897089 | - | NZ_AP022610.1 | Mycolicibacterium madagascariense |
++ More..