Result : EXP01826
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01826 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 6947698 |
| Right | 6947787 |
| Strand | + |
| Nucleotide Sequence | ATGCCGAAGGTGATCAGCGGCAGCAGCACCATCACGGCGACGGCGATCGCAGAACCGCGTCGCACCCACTTCCAGTTGATGCGGAACTGA |
| Sequence | MPKVISGSSTITATAIAEPRRTHFQLMRN |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 6942191 | 6942280 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 1345811 | 1345900 | + | NZ_CP012150.1 | Mycobacterium goodii |
| 3 | 4343620 | 4343700 | + | NZ_AP022601.1 | Mycobacterium gallinarum |
| 4 | 4316202 | 4316282 | - | NZ_AP022608.1 | Mycolicibacterium gadium |
| 5 | 1207844 | 1207927 | + | NZ_AP014879.1 | Sulfuricaulis limicola |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00436.27 | 0.6 | 3 | 4877 | opposite-strand | Single-strand binding protein family |
| 2 | PF01250.19 | 0.6 | 3 | 4514 | opposite-strand | Ribosomal protein S6 |
| 3 | PF09594.12 | 0.8 | 4 | 2083.0 | opposite-strand | Glycosyltransferase family 87 |
| 4 | PF00912.24 | 0.8 | 4 | -84.5 | opposite-strand | Transglycosylase |
| 5 | PF00905.24 | 0.8 | 4 | -84.5 | opposite-strand | Penicillin binding protein transpeptidase domain |
| 6 | PF17249.4 | 0.8 | 4 | 334.0 | opposite-strand | Family of unknown function (DUF5318) |
| 7 | PF08044.13 | 0.8 | 4 | 965.0 | same-strand | Domain of unknown function (DUF1707) |
| 8 | PF03551.16 | 0.8 | 4 | 1858.0 | same-strand | Transcriptional regulator PadR-like family |
| 9 | PF10400.11 | 0.8 | 4 | 1858.0 | same-strand | Virulence activator alpha C-term |
| 10 | PF01658.19 | 0.6 | 3 | 2455 | same-strand | Myo-inositol-1-phosphate synthase |
++ More..