Result : EXP01824
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01824 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 3166485 |
| Right | 3166562 |
| Strand | + |
| Nucleotide Sequence | GTGGTACCGAGCGTCAGTCCGATGACCGCGCCGCGCAGCCGGGCCTCACGGTGCGGTGTCCGGTTTCCCATGAAGTAG |
| Sequence | VVPSVSPMTAPRSRASRCGVRFPMK |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 25
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3229394 | 3229471 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 5199948 | 5200025 | - | NZ_CP012150.1 | Mycobacterium goodii |
| 3 | 3382627 | 3382704 | - | NC_009767.1 | Roseiflexus castenholzii DSM 13941 |
| 4 | 1091923 | 1092009 | + | NZ_CP016211.1 | Minicystis rosea |
| 5 | 792453 | 792542 | + | NZ_CP029487.1 | Eubacterium maltosivorans |
| 6 | 2147534 | 2147623 | + | NC_014624.2 | Eubacterium callanderi |
| 7 | 3889115 | 3889204 | + | NZ_CP019962.1 | Eubacterium limosum |
| 8 | 432366 | 432431 | - | NC_008148.1 | Rubrobacter xylanophilus DSM 9941 |
| 9 | 3141268 | 3141345 | - | NC_007510.1 | Burkholderia lata |
| 10 | 3049263 | 3049340 | - | NZ_CP013401.1 | Burkholderia metallica |
| 11 | 2570795 | 2570881 | + | NC_014334.2 | Lacticaseibacillus paracasei |
| 12 | 2289837 | 2289902 | + | NZ_AP021861.1 | Lacipirellula parvula |
| 13 | 8770226 | 8770297 | + | NZ_CP063849.1 | Paludibaculum fermentans |
| 14 | 864156 | 864245 | - | NC_014722.1 | Mycetohabitans rhizoxinica HKI 454 |
| 15 | 2991939 | 2992007 | + | NZ_CP060052.1 | Croceicoccus marinus |
| 16 | 1790620 | 1790709 | - | NZ_CP035900.1 | Burkholderia glumae |
| 17 | 3687037 | 3687126 | - | NZ_CP002580.1 | Burkholderia plantarii |
| 18 | 446737 | 446814 | + | NZ_CP009795.1 | Burkholderia dolosa AU0158 |
| 19 | 373309 | 373386 | - | NZ_LT635455.1 | Olsenella timonensis |
| 20 | 1817107 | 1817193 | + | NZ_CP022989.1 | Paraburkholderia aromaticivorans |
| 21 | 499571 | 499648 | - | NZ_CP035765.1 | Sphingomonas paucimobilis |
| 22 | 4510032 | 4510097 | + | NZ_CP036291.1 | Pirellulimonas nuda |
| 23 | 4648039 | 4648104 | + | NZ_AP022588.1 | Mycolicibacterium sediminis |
| 24 | 3117027 | 3117104 | - | NZ_CP071057.1 | Marinicauda algicola |
| 25 | 745596 | 745667 | - | NZ_CP024422.1 | Paracoccus yeei |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02782.18 | 0.92 | 23 | -77 | opposite-strand | FGGY family of carbohydrate kinases, C-terminal domain |
| 2 | PF00370.23 | 0.92 | 23 | -77 | opposite-strand | FGGY family of carbohydrate kinases, N-terminal domain |
++ More..