Protein Information |
Information Type | Description |
---|---|
Protein name | EXP01820 |
NCBI Accession ID | CP000480.1 |
Organism | Mycolicibacterium smegmatis MC2 155 |
Left | 1343050 |
Right | 1343124 |
Strand | + |
Nucleotide Sequence | GTGAACGGGTGGACCCTGTGTCCCCCCGACGTGAATGAGATTGTCGAGGCCTTGAAAACGAACGGAGTTGTGTAG |
Sequence | VNGWTLCPPDVNEIVEALKTNGVV |
Source of smORF | Transcriptional-level |
Function | |
Pubmed ID | 32181921 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 24 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1421959 | 1422033 | + | NZ_CP020809.1 | Mycobacterium dioxanotrophicus |
2 | 2603610 | 2603684 | - | NZ_AP022565.1 | Mycolicibacterium alvei |
3 | 632511 | 632585 | + | NC_015576.1 | Mycolicibacter sinensis |
4 | 1816316 | 1816396 | - | NZ_CP018082.1 | Nocardia mangyaensis |
5 | 2566201 | 2566281 | - | NZ_AP017900.1 | Nocardia seriolae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF13245.8 | 1.0 | 5 | 1.0 | same-strand | AAA domain |
2 | PF13538.8 | 0.6 | 3 | 1 | same-strand | UvrD-like helicase C-terminal domain |