Result : EXP01820
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01820 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 1343050 |
| Right | 1343124 |
| Strand | + |
| Nucleotide Sequence | GTGAACGGGTGGACCCTGTGTCCCCCCGACGTGAATGAGATTGTCGAGGCCTTGAAAACGAACGGAGTTGTGTAG |
| Sequence | VNGWTLCPPDVNEIVEALKTNGVV |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1421959 | 1422033 | + | NZ_CP020809.1 | Mycobacterium dioxanotrophicus |
| 2 | 2603610 | 2603684 | - | NZ_AP022565.1 | Mycolicibacterium alvei |
| 3 | 632511 | 632585 | + | NC_015576.1 | Mycolicibacter sinensis |
| 4 | 1816316 | 1816396 | - | NZ_CP018082.1 | Nocardia mangyaensis |
| 5 | 2566201 | 2566281 | - | NZ_AP017900.1 | Nocardia seriolae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP020809.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13245.8 | 1.0 | 5 | 1.0 | same-strand | AAA domain |
| 2 | PF13538.8 | 0.6 | 3 | 1 | same-strand | UvrD-like helicase C-terminal domain |
++ More..