Result : EXP01819
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01819 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 2453995 |
| Right | 2454066 |
| Strand | + |
| Nucleotide Sequence | ATGCAGACCCCGGGAGTGCTCGTAGTAATTGGTTGGCGCGTTGATGCCGCGCTGGCCCTCTGCCGGGCATAG |
| Sequence | MQTPGVLVVIGWRVDAALALCRA |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 23 |
++ More..
| Conservation Analysis |
No. of Species: 20
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5925856 | 5925927 | - | NZ_CP012150.1 | Mycobacterium goodii |
| 2 | 2521895 | 2521966 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 3 | 4839077 | 4839148 | - | NZ_CP020809.1 | Mycobacterium dioxanotrophicus |
| 4 | 5384895 | 5384966 | - | NZ_AP022579.1 | Mycolicibacterium boenickei |
| 5 | 2376447 | 2376518 | + | NZ_CP011269.1 | Mycolicibacterium fortuitum |
| 6 | 2502433 | 2502504 | - | NZ_AP022586.1 | Mycolicibacterium litorale |
| 7 | 5468242 | 5468313 | + | NZ_AP022567.1 | Mycolicibacterium mageritense |
| 8 | 1619970 | 1620041 | - | NZ_AP022565.1 | Mycolicibacterium alvei |
| 9 | 402881 | 402952 | - | NZ_AP022599.1 | Mycolicibacterium pulveris |
| 10 | 4649526 | 4649597 | - | NZ_AP022574.1 | Mycolicibacterium psychrotolerans |
| 11 | 2516254 | 2516325 | - | NZ_AP022563.1 | Mycolicibacterium duvalii |
| 12 | 1649463 | 1649534 | + | NZ_LT906483.1 | Mycolicibacterium thermoresistibile |
| 13 | 2264411 | 2264476 | + | NC_008726.1 | Mycolicibacterium vanbaalenii PYR-1 |
| 14 | 5345349 | 5345414 | - | NZ_AP022598.1 | Mycolicibacterium parafortuitum |
| 15 | 1836795 | 1836866 | + | NZ_AP022561.1 | Mycolicibacterium aichiense |
| 16 | 2566780 | 2566851 | + | NZ_AP022570.1 | Mycolicibacterium poriferae |
| 17 | 4817511 | 4817582 | - | NZ_AP022595.1 | Mycolicibacterium sarraceniae |
| 18 | 7385 | 7456 | - | NZ_AP022595.1 | Mycolicibacterium sarraceniae |
| 19 | 2073740 | 2073805 | + | NZ_LR134356.1 | Mycolicibacterium aurum |
| 20 | 391821 | 391892 | + | NZ_AP022620.1 | Mycolicibacterium anyangense |
| 21 | 4509772 | 4509840 | + | NZ_AP022596.1 | Mycolicibacterium helvum |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP012150.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07991.14 | 1.0 | 20 | 2563.5 | same-strand | Acetohydroxy acid isomeroreductase, NADPH-binding domain |
| 2 | PF01450.21 | 1.0 | 20 | 2563.5 | same-strand | Acetohydroxy acid isomeroreductase, catalytic domain |
| 3 | PF10369.11 | 1.0 | 20 | 1998 | same-strand | Small subunit of acetolactate synthase |
| 4 | PF13710.8 | 1.0 | 20 | 1997.5 | same-strand | ACT domain |
| 5 | PF01842.27 | 1.0 | 20 | 2004 | same-strand | ACT domain |
| 6 | PF13291.8 | 1.0 | 20 | 1997.5 | same-strand | ACT domain |
| 7 | PF02776.20 | 1.0 | 20 | 122 | same-strand | Thiamine pyrophosphate enzyme, N-terminal TPP binding domain |
| 8 | PF00205.24 | 1.0 | 20 | 122 | same-strand | Thiamine pyrophosphate enzyme, central domain |
| 9 | PF02775.23 | 1.0 | 20 | 123.0 | same-strand | Thiamine pyrophosphate enzyme, C-terminal TPP binding domain |
| 10 | PF10756.11 | 1.0 | 20 | 150 | opposite-strand | Bacterial PH domain |
| 11 | PF07681.14 | 1.0 | 20 | 507.0 | same-strand | DoxX |
| 12 | PF02934.17 | 0.7 | 14 | 3410.0 | same-strand | GatB/GatE catalytic domain |
| 13 | PF02637.20 | 0.7 | 14 | 3410.0 | same-strand | GatB domain |
++ More..