Result : EXP01818
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01818 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 2082659 |
| Right | 2082727 |
| Strand | + |
| Nucleotide Sequence | GTGATCACGGAGCTGAGAAGCGAATCGGATTCGGAGAAGCCCACCGACTGCCACAGCGTGGTCGAGTAG |
| Sequence | VITELRSESDSEKPTDCHSVVE |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 50
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2157631 | 2157699 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 3692058 | 3692126 | - | NZ_CP059694.1 | Gordonia rubripertincta |
| 3 | 52561 | 52629 | + | NC_014550.1 | Glutamicibacter arilaitensis Re117 |
| 4 | 3898926 | 3898994 | + | NZ_CP031422.1 | Microbacterium oxydans |
| 5 | 2592631 | 2592699 | + | NZ_CP042260.1 | Glutamicibacter halophytocola |
| 6 | 3559662 | 3559730 | + | NZ_CP031425.1 | Microbacterium foliorum |
| 7 | 3550824 | 3550892 | + | NC_016906.1 | Gordonia polyisoprenivorans VH2 |
| 8 | 1245801 | 1245869 | - | NZ_CP011853.1 | Gordonia phthalatica |
| 9 | 2316759 | 2316827 | + | NZ_CP071883.1 | Curtobacterium flaccumfaciens pv. flaccumfaciens |
| 10 | 269089 | 269157 | - | NZ_CP022316.1 | Brachybacterium avium |
| 11 | 44806 | 44874 | + | NZ_CP033081.1 | Glutamicibacter nicotianae |
| 12 | 48114 | 48182 | + | NZ_CP034412.1 | Glutamicibacter creatinolyticus |
| 13 | 3716602 | 3716670 | - | NZ_CP015449.1 | Dietzia lutea |
| 14 | 2104389 | 2104445 | - | NZ_CP031423.1 | Microbacterium lemovicicum |
| 15 | 3461937 | 3462005 | - | NZ_CP027114.1 | Gordonia alkanivorans |
| 16 | 1535767 | 1535835 | - | NZ_CP033724.1 | Clavibacter michiganensis subsp. michiganensis |
| 17 | 2119367 | 2119435 | - | NZ_CP014209.1 | Isoptericola dokdonensis DS-3 |
| 18 | 2456424 | 2456492 | - | NZ_CP025333.1 | Brevibacterium aurantiacum |
| 19 | 3570810 | 3570878 | + | NC_013441.1 | Gordonia bronchialis DSM 43247 |
| 20 | 389980 | 390048 | + | NC_015588.1 | Isoptericola variabilis 225 |
| 21 | 2028209 | 2028277 | + | NC_015588.1 | Isoptericola variabilis 225 |
| 22 | 2005631 | 2005687 | - | NZ_CP059082.1 | Halomonas titanicae |
| 23 | 155177 | 155236 | - | NZ_CP013106.1 | Halomonas huangheensis |
| 24 | 3177299 | 3177367 | - | NZ_CP065682.1 | Brevibacterium casei |
| 25 | 3467055 | 3467123 | + | NC_009664.2 | Kineococcus radiotolerans SRS30216 = ATCC BAA-149 |
| 26 | 27674 | 27733 | + | NZ_CP048812.1 | Halomonas socia |
| 27 | 3700056 | 3700124 | + | NZ_CP045529.1 | Luteimicrobium xylanilyticum |
| 28 | 4022201 | 4022269 | - | NZ_CP030033.1 | Cryobacterium soli |
| 29 | 2728664 | 2728732 | + | NZ_CP016282.1 | Cryobacterium arcticum |
| 30 | 3852896 | 3852952 | - | NZ_CP068013.1 | Paenarthrobacter ureafaciens |
| 31 | 3137646 | 3137714 | - | NC_014151.1 | Cellulomonas flavigena DSM 20109 |
| 32 | 18387 | 18446 | + | NZ_CP043476.1 | Xanthomonas hyacinthi |
| 33 | 3127798 | 3127866 | - | NZ_CP051884.1 | Cellulomonas taurus |
| 34 | 1611850 | 1611906 | + | NC_010168.1 | Renibacterium salmoninarum ATCC 33209 |
| 35 | 2951021 | 2951089 | - | NC_015671.1 | Cellulomonas gilvus ATCC 13127 |
| 36 | 4286473 | 4286541 | + | NC_012669.1 | Beutenbergia cavernae DSM 12333 |
| 37 | 2743927 | 2743995 | - | NZ_CP012507.1 | Kocuria palustris |
| 38 | 3250799 | 3250867 | - | NZ_CP029642.1 | Arthrobacter dokdonellae |
| 39 | 2319801 | 2319869 | - | NZ_CP029642.1 | Arthrobacter dokdonellae |
| 40 | 2504375 | 2504443 | - | NZ_CP018863.1 | Arthrobacter crystallopoietes |
| 41 | 2791028 | 2791096 | - | NZ_LT906473.1 | Corynebacterium cystitidis |
| 42 | 2435163 | 2435219 | + | NZ_CP011005.1 | Psychromicrobium lacuslunae |
| 43 | 5943320 | 5943397 | - | NC_019693.1 | Oscillatoria acuminata PCC 6304 |
| 44 | 2682599 | 2682667 | + | NZ_CP011340.1 | Streptomyces pristinaespiralis |
| 45 | 193512 | 193571 | - | NC_014532.2 | Halomonas elongata DSM 2581 |
| 46 | 787488 | 787556 | + | NZ_CP039291.1 | Cellulomonas shaoxiangyii |
| 47 | 319578 | 319634 | - | NZ_CP048813.1 | Rhodococcus triatomae |
| 48 | 4505547 | 4505612 | - | NZ_CP032229.1 | Streptomyces seoulensis |
| 49 | 1854067 | 1854135 | - | NZ_CP060820.1 | Lysobacter solisilvae (ex Woo and Kim 2020) |
| 50 | 2095918 | 2095977 | - | NZ_CP011028.1 | Pseudoalteromonas espejiana DSM 9414 |
| 51 | 848521 | 848589 | - | NZ_LS483468.1 | Rhodococcus coprophilus |
| 52 | 2683162 | 2683230 | + | NZ_CP022208.1 | Rhodococcus pyridinivorans |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00083.26 | 0.96 | 48 | -68.0 | opposite-strand | Sugar (and other) transporter |
| 2 | PF07690.18 | 0.96 | 48 | -68 | opposite-strand | Major Facilitator Superfamily |
++ More..