Protein name |
EXP01817 |
NCBI Accession ID |
CP000480.1 |
Organism |
Mycolicibacterium smegmatis MC2 155 |
Left |
1012274 |
Right |
1012342 |
Strand |
+ |
Nucleotide Sequence |
GTGACCCGGAAGTCCCAGCGCTGTTTCGCGCAGTGTGCGTGTTGTTGTTGCGCACACTGCCGCGCCTGA |
Sequence |
VTRKSQRCFAQCACCCCAHCRA |
Source of smORF |
Transcriptional-level |
Function |
It is a leaderless short ORF in mycobacteria. Encodes a polycysteine tract which makes it a cysteine-responsive regulator of operonic gene expression. Pubmed:32181921 |
Pubmed ID |
32181921
|
Domain |
|
Functional Category |
Manually curated function from literature |
Uniprot ID |
|
ORF Length (Amino Acid) |
22 |