| Protein name |
EXP01817 |
| NCBI Accession ID |
CP000480.1 |
| Organism |
Mycolicibacterium smegmatis MC2 155 |
| Left |
1012274 |
| Right |
1012342 |
| Strand |
+ |
| Nucleotide Sequence |
GTGACCCGGAAGTCCCAGCGCTGTTTCGCGCAGTGTGCGTGTTGTTGTTGCGCACACTGCCGCGCCTGA |
| Sequence |
VTRKSQRCFAQCACCCCAHCRA |
| Source of smORF |
Transcriptional-level |
| Function |
It is a leaderless short ORF in mycobacteria. Encodes a polycysteine tract which makes it a cysteine-responsive regulator of operonic gene expression. Pubmed:32181921 |
| Pubmed ID |
32181921
|
| Domain |
|
| Functional Category |
Manually curated function from literature |
| Uniprot ID |
|
| ORF Length (Amino Acid) |
22 |