Result : EXP01816
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01816 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 1309947 |
| Right | 1310015 |
| Strand | + |
| Nucleotide Sequence | GTGGATCAAAATTTGCCAGGCTTTGGTGCAATGGAAGATGCATTTATGAACTGGGAGGATGTTTGGTGA |
| Sequence | VDQNLPGFGAMEDAFMNWEDVW |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2888119 | 2888196 | - | NC_015564.1 | Hoyosella subflava DQS3-9A1 |
| 2 | 657326 | 657403 | + | NC_013093.1 | Actinosynnema mirum DSM 43827 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015564.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13182.8 | 1.0 | 2 | 4588.0 | both-strands | Protein of unknown function (DUF4007) |
| 2 | PF00266.21 | 1.0 | 2 | 4561.5 | both-strands | Aminotransferase class-V |
++ More..