Result : EXP01813
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01813 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 1438060 |
| Right | 1438125 |
| Strand | + |
| Nucleotide Sequence | GTGTGGACACTGGAAGGTGACCTGGACGAACCAGTCCGCTATGAAGAGGAACGGAGTATGCGGTGA |
| Sequence | VWTLEGDLDEPVRYEEERSMR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 6869842 | 6869907 | - | NZ_CP012150.1 | Mycobacterium goodii |
| 2 | 1515194 | 1515259 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP012150.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04542.16 | 1.0 | 2 | 2693.5 | opposite-strand | Sigma-70 region 2 |
| 2 | PF08281.14 | 1.0 | 2 | 2693.5 | opposite-strand | Sigma-70, region 4 |
| 3 | PF04545.18 | 1.0 | 2 | 2693.5 | opposite-strand | Sigma-70, region 4 |
| 4 | PF00687.23 | 1.0 | 2 | 1910.0 | same-strand | Ribosomal protein L1p/L10e family |
| 5 | PF03946.16 | 1.0 | 2 | 1381.5 | same-strand | Ribosomal protein L11, N-terminal domain |
| 6 | PF00298.21 | 1.0 | 2 | 1381.5 | same-strand | Ribosomal protein L11, RNA binding domain |
| 7 | PF02357.21 | 1.0 | 2 | 461.0 | same-strand | Transcription termination factor nusG |
| 8 | PF00584.22 | 1.0 | 2 | -3.0 | same-strand | SecE/Sec61-gamma subunits of protein translocation complex |
| 9 | PF13452.8 | 1.0 | 2 | 735.5 | same-strand | N-terminal half of MaoC dehydratase |
| 10 | PF01575.21 | 1.0 | 2 | 788.5 | same-strand | MaoC like domain |
| 11 | PF00471.22 | 1.0 | 2 | 1690.5 | same-strand | Ribosomal protein L33 |
| 12 | PF00042.24 | 1.0 | 2 | 2199.0 | same-strand | Globin |
| 13 | PF00175.23 | 1.0 | 2 | 2199.0 | same-strand | Oxidoreductase NAD-binding domain |
| 14 | PF11563.10 | 1.0 | 2 | 2199.0 | same-strand | Protoglobin |
++ More..