Result : EXP01811
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01811 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 2024947 |
| Right | 2025009 |
| Strand | + |
| Nucleotide Sequence | GTGCGACTGCTCGGATCGGTCCAGGCAAACACTGGCCGGCTGTCCTGGATGACTCGTGGCTAA |
| Sequence | VRLLGSVQANTGRLSWMTRG |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2090934 | 2090996 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 6264752 | 6264814 | - | NZ_CP012150.1 | Mycobacterium goodii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12705.9 | 1.0 | 2 | 4526 | same-strand | PD-(D/E)XK nuclease superfamily |
| 2 | PF00580.23 | 1.0 | 2 | 3145.0 | same-strand | UvrD/REP helicase N-terminal domain |
| 3 | PF13245.8 | 1.0 | 2 | 3145.0 | same-strand | AAA domain |
| 4 | PF13361.8 | 1.0 | 2 | 3145.0 | same-strand | UvrD-like helicase C-terminal domain |
| 5 | PF01988.21 | 1.0 | 2 | 513.0 | opposite-strand | VIT family |
| 6 | PF02254.20 | 1.0 | 2 | -7.0 | same-strand | TrkA-N domain |
| 7 | PF07885.18 | 1.0 | 2 | -7.0 | same-strand | Ion channel |
| 8 | PF00293.30 | 1.0 | 2 | 1084.0 | same-strand | NUDIX domain |
| 9 | PF09297.13 | 1.0 | 2 | 1084.0 | same-strand | NADH pyrophosphatase zinc ribbon domain |
| 10 | PF00462.26 | 1.0 | 2 | 2041.0 | opposite-strand | Glutaredoxin |
++ More..