Result : EXP01810
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01810 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 5625225 |
| Right | 5625284 |
| Strand | + |
| Nucleotide Sequence | GTGCTCATTGAGCAGAGGCGATTTTTCTACGGGTACCGGCCTGCGGTGCCCGTGGTCTAG |
| Sequence | VLIEQRRFFYGYRPAVPVV |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 41
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5632158 | 5632217 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 2035568 | 2035627 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
| 3 | 2749183 | 2749242 | - | NZ_CP012150.1 | Mycobacterium goodii |
| 4 | 3421433 | 3421492 | + | NZ_AP022581.1 | Mycobacterium lacus |
| 5 | 1068254 | 1068313 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 6 | 1058034 | 1058093 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 7 | 1991634 | 1991693 | - | NZ_AP022574.1 | Mycolicibacterium psychrotolerans |
| 8 | 4903927 | 4903986 | + | NZ_CP011491.1 | Mycolicibacterium vaccae 95051 |
| 9 | 5494737 | 5494796 | - | NZ_AP022563.1 | Mycolicibacterium duvalii |
| 10 | 3056477 | 3056536 | - | NZ_AP022615.1 | Mycobacterium heidelbergense |
| 11 | 2630518 | 2630577 | + | NZ_AP022573.1 | Mycobacterium saskatchewanense |
| 12 | 3100598 | 3100654 | + | NZ_AP022605.1 | Mycobacterium doricum |
| 13 | 26271 | 26327 | - | NZ_AP022617.1 | Mycolicibacterium monacense |
| 14 | 3485920 | 3485979 | + | NZ_AP022601.1 | Mycobacterium gallinarum |
| 15 | 3333525 | 3333584 | + | NZ_AP022608.1 | Mycolicibacterium gadium |
| 16 | 2445312 | 2445371 | + | NZ_AP022569.1 | Mycobacterium cookii |
| 17 | 2689082 | 2689141 | - | NZ_AP022589.1 | Mycolicibacter minnesotensis |
| 18 | 5634416 | 5634475 | + | NZ_CP025546.1 | Mycobacterium paragordonae |
| 19 | 952501 | 952563 | - | NZ_AP022561.1 | Mycolicibacterium aichiense |
| 20 | 405287 | 405346 | - | NZ_AP022609.1 | Mycolicibacter hiberniae |
| 21 | 962590 | 962649 | - | NC_015576.1 | Mycolicibacter sinensis |
| 22 | 1023932 | 1023991 | + | NZ_AP022562.1 | Mycobacterium novum |
| 23 | 5492222 | 5492278 | - | NZ_AP022586.1 | Mycolicibacterium litorale |
| 24 | 2464525 | 2464584 | - | NZ_AP022606.1 | Mycobacterium branderi |
| 25 | 3388344 | 3388406 | - | NZ_AP022596.1 | Mycolicibacterium helvum |
| 26 | 4577200 | 4577259 | + | NZ_LR130759.1 | Mycobacterium basiliense |
| 27 | 4899028 | 4899087 | - | NZ_AP022593.1 | Mycolicibacterium arabiense |
| 28 | 4782079 | 4782138 | + | NZ_AP022613.1 | Mycobacterium conspicuum |
| 29 | 4240268 | 4240327 | + | NZ_AP022618.1 | Mycolicibacterium insubricum |
| 30 | 3769890 | 3769949 | - | NZ_AP022603.1 | Mycolicibacterium fallax |
| 31 | 928314 | 928373 | - | NZ_CP024633.1 | Mycobacteroides salmoniphilum |
| 32 | 2920362 | 2920421 | + | NZ_AP022616.1 | Mycolicibacterium phocaicum |
| 33 | 6079162 | 6079221 | + | NZ_AP022588.1 | Mycolicibacterium sediminis |
| 34 | 2596967 | 2597026 | - | NZ_AP022598.1 | Mycolicibacterium parafortuitum |
| 35 | 1123506 | 1123565 | - | NZ_CP011530.1 | Mycobacteroides immunogenum |
| 36 | 871446 | 871505 | - | NZ_CP062008.1 | Mycolicibacterium mucogenicum DSM 44124 |
| 37 | 1040051 | 1040110 | - | NZ_CP007220.1 | Mycobacteroides chelonae CCUG 47445 |
| 38 | 1008352 | 1008411 | - | NZ_AP018165.1 | [Mycobacterium] stephanolepidis |
| 39 | 4278177 | 4278236 | - | NZ_AP022577.1 | Mycolicibacterium aubagnense |
| 40 | 4747651 | 4747710 | + | NZ_AP022610.1 | Mycolicibacterium madagascariense |
| 41 | 737093 | 737152 | + | NZ_AP022595.1 | Mycolicibacterium sarraceniae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_AP022581.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00580.23 | 1.0 | 41 | 99 | opposite-strand | UvrD/REP helicase N-terminal domain |
| 2 | PF13361.8 | 1.0 | 41 | 99 | opposite-strand | UvrD-like helicase C-terminal domain |
| 3 | PF13245.8 | 1.0 | 41 | 99 | opposite-strand | AAA domain |
| 4 | PF13538.8 | 1.0 | 41 | 99 | opposite-strand | UvrD-like helicase C-terminal domain |
| 5 | PF00342.21 | 0.98 | 40 | 1533.5 | same-strand | Phosphoglucose isomerase |
| 6 | PF08442.12 | 0.93 | 38 | 4387.5 | opposite-strand | ATP-grasp domain |
| 7 | PF00549.21 | 0.93 | 38 | 5164.0 | opposite-strand | CoA-ligase |
| 8 | PF13549.8 | 0.9 | 37 | 4373 | opposite-strand | ATP-grasp domain |
| 9 | PF01551.24 | 0.93 | 38 | 3064.5 | same-strand | Peptidase family M23 |
| 10 | PF02629.21 | 0.83 | 34 | 5549.0 | opposite-strand | CoA binding domain |
| 11 | PF13607.8 | 0.83 | 34 | 5549.0 | opposite-strand | Succinyl-CoA ligase like flavodoxin domain |
++ More..