Result : EXP01807
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01807 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 3976145 |
| Right | 3976201 |
| Strand | + |
| Nucleotide Sequence | GTGTGTGGTCTAGGAACTCGACACACCAGCACCGCTGTTAACCTCTCTGTTCAGTAG |
| Sequence | VCGLGTRHTSTAVNLSVQ |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4053330 | 4053386 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 4390715 | 4390771 | - | NZ_CP012150.1 | Mycobacterium goodii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF05721.15 | 1.0 | 2 | 4901.0 | opposite-strand | Phytanoyl-CoA dioxygenase (PhyH) |
| 2 | PF06339.14 | 1.0 | 2 | 4488.0 | opposite-strand | Ectoine synthase |
| 3 | PF07883.13 | 1.0 | 2 | 4488.0 | opposite-strand | Cupin domain |
| 4 | PF00202.23 | 1.0 | 2 | 3190.0 | opposite-strand | Aminotransferase class-III |
| 5 | PF00004.31 | 1.0 | 2 | 69.0 | opposite-strand | ATPase family associated with various cellular activities (AAA) |
| 6 | PF17758.3 | 1.0 | 2 | 69.0 | opposite-strand | Proteasomal ATPase OB N-terminal domain |
| 7 | PF16450.7 | 1.0 | 2 | 69.0 | opposite-strand | Proteasomal ATPase OB C-terminal domain |
| 8 | PF04456.14 | 1.0 | 2 | 1098.0 | same-strand | Protein of unknown function (DUF503) |
| 9 | PF12705.9 | 1.0 | 2 | 2329.0 | same-strand | PD-(D/E)XK nuclease superfamily |
++ More..