Result : EXP01806

Protein Information

• Protein name: EXP01806
• NCBI Accession ID: CP000480.1
• Organism: Mycolicibacterium smegmatis MC2 155
• Left: 979951
• Right: 980007
• Strand: +
• Nucleotide Sequence: ATGCATCCGCCGCGCCGCCACCCGCGGCGCGGGACACAAGGAGACGACGCACCGTGA
• Sequence: MHPPRRHPRRGTQGDDAP
• Source of smORF: Transcriptional-level
• Pubmed ID: 32181921
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 18

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	157501	157557	-	NZ_CP012150.1	Mycobacterium goodii
2	1014117	1014173	+	NZ_LN831039.1	Mycolicibacterium smegmatis

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NZ_CP012150.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00326.23	1.0	2	4306.5	opposite-strand	Prolyl oligopeptidase family
2	PF01116.22	1.0	2	3454.0	same-strand	Fructose-bisphosphate aldolase class-II
3	PF07005.13	1.0	2	2180.0	same-strand	Sugar-binding N-terminal domain
4	PF17042.7	1.0	2	2180.0	same-strand	Nucleotide-binding C-terminal domain
5	PF07690.18	1.0	2	813.0	same-strand	Major Facilitator Superfamily
6	PF00392.23	1.0	2	-3	same-strand	Bacterial regulatory proteins, gntR family
7	PF07729.14	1.0	2	-3	same-strand	FCD domain
8	PF08666.14	1.0	2	47.0	same-strand	SAF domain