Result : EXP01804

Protein Information

• Protein name: EXP01804
• NCBI Accession ID: CP000480.1
• Organism: Mycolicibacterium smegmatis MC2 155
• Left: 5988445
• Right: 5988498
• Strand: +
• Nucleotide Sequence: ATGATCACCAGCACCAGGCAGATCGCGACGGTCGCGGCGATCGCCAGCGTGTAG
• Sequence: MITSTRQIATVAAIASV
• Source of smORF: Transcriptional-level
• Pubmed ID: 32181921
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 17

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	5995727	5995780	+	NZ_LN831039.1	Mycolicibacterium smegmatis
2	4449613	4449666	-	NZ_LT906450.1	Rhodococcus rhodochrous
3	4712886	4712939	-	NZ_CP022208.1	Rhodococcus pyridinivorans

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NZ_LT906450.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF16316.7	1.0	3	-53	opposite-strand	Domain of unknown function (DUF4956)
2	PF02308.18	1.0	3	-53	opposite-strand	MgtC family
3	PF09359.12	1.0	3	364	opposite-strand	VTC domain
4	PF02518.28	0.67	2	2043.0	same-strand	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase
5	PF00512.27	0.67	2	2043.0	same-strand	His Kinase A (phospho-acceptor) domain
6	PF00672.27	0.67	2	2043.0	same-strand	HAMP domain
7	PF00072.26	0.67	2	1289.5	same-strand	Response regulator receiver domain
8	PF00486.30	0.67	2	1289.5	same-strand	Transcriptional regulatory protein, C terminal
9	PF00378.22	0.67	2	1838.5	opposite-strand	Enoyl-CoA hydratase/isomerase