Result : EXP01800
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01800 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 415754 |
| Right | 415804 |
| Strand | + |
| Nucleotide Sequence | ATGGTCGACTCGAGACCCGTGGCGCCCGGCTTGGCGTCGGCCGAGAGATAG |
| Sequence | MVDSRPVAPGLASAER |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 393913 | 393963 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 2157795 | 2157845 | - | NZ_AP022568.1 | Mycobacterium simiae |
| 3 | 438243 | 438293 | + | NZ_LR130759.1 | Mycobacterium basiliense |
| 4 | 298255 | 298305 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 5 | 291497 | 291547 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 6 | 287135 | 287185 | + | NZ_LT906483.1 | Mycolicibacterium thermoresistibile |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_AP022568.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13561.8 | 1.0 | 6 | -50.0 | opposite-strand | Enoyl-(Acyl carrier protein) reductase |
| 2 | PF00106.27 | 1.0 | 6 | -50.0 | opposite-strand | short chain dehydrogenase |
| 3 | PF08659.12 | 1.0 | 6 | -50.0 | opposite-strand | KR domain |
| 4 | PF00108.25 | 1.0 | 6 | 624.0 | same-strand | Thiolase, N-terminal domain |
| 5 | PF02803.20 | 1.0 | 6 | 624.0 | same-strand | Thiolase, C-terminal domain |
| 6 | PF01613.20 | 0.67 | 4 | 4541.0 | same-strand | Flavin reductase like domain |
| 7 | PF12806.9 | 0.83 | 5 | 2263 | opposite-strand | Acetyl-CoA dehydrogenase C-terminal like |
| 8 | PF02770.21 | 0.83 | 5 | 2263 | opposite-strand | Acyl-CoA dehydrogenase, middle domain |
| 9 | PF00441.26 | 0.83 | 5 | 2263 | opposite-strand | Acyl-CoA dehydrogenase, C-terminal domain |
| 10 | PF12418.10 | 0.83 | 5 | 2263 | opposite-strand | Acyl-CoA dehydrogenase N terminal |
| 11 | PF00440.25 | 0.83 | 5 | 2741 | same-strand | Bacterial regulatory proteins, tetR family |
| 12 | PF17932.3 | 0.67 | 4 | 2881.5 | same-strand | Tetracyclin repressor-like, C-terminal domain |
++ More..