Result : EXP01799
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01799 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 1036817 |
| Right | 1036867 |
| Strand | + |
| Nucleotide Sequence | ATGAGCGTGCGCTACAGCAAATACGCCCGGCAGGCCTATGCCCGGGCCTGA |
| Sequence | MSVRYSKYARQAYARA |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1071010 | 1071060 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 80181 | 80231 | - | NZ_CP012150.1 | Mycobacterium goodii |
| 3 | 3973524 | 3973574 | + | NZ_AP022567.1 | Mycolicibacterium mageritense |
| 4 | 4155299 | 4155352 | - | NZ_AP022617.1 | Mycolicibacterium monacense |
| 5 | 235637 | 235687 | - | NZ_AP022579.1 | Mycolicibacterium boenickei |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00440.25 | 1.0 | 5 | -13 | same-strand | Bacterial regulatory proteins, tetR family |
++ More..