Protein Information |
Information Type | Description |
---|---|
Protein name | EXP01798 |
NCBI Accession ID | CP000480.1 |
Organism | Mycolicibacterium smegmatis MC2 155 |
Left | 117072 |
Right | 117119 |
Strand | + |
Nucleotide Sequence | GTGACGCCCAGTCGGTTGCATACTTCGGCCAATTTGAGACCGCCGTAG |
Sequence | VTPSRLHTSANLRPP |
Source of smORF | Transcriptional-level |
Function | |
Pubmed ID | 32181921 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 15 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1543988 | 1544035 | + | NZ_CP012150.1 | Mycobacterium goodii |
2 | 131763 | 131810 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
3 | 7429650 | 7429697 | - | NZ_CP020809.1 | Mycobacterium dioxanotrophicus |
4 | 702607 | 702654 | + | NZ_AP022570.1 | Mycolicibacterium poriferae |
5 | 5667155 | 5667202 | - | NZ_AP022561.1 | Mycolicibacterium aichiense |
6 | 1968191 | 1968238 | + | NZ_AP022589.1 | Mycolicibacter minnesotensis |
7 | 323096 | 323143 | - | NZ_AP022560.1 | Mycolicibacterium moriokaense |
8 | 1356441 | 1356488 | - | NZ_AP022598.1 | Mycolicibacterium parafortuitum |
9 | 5801103 | 5801153 | + | NZ_AP022576.1 | Mycobacterium florentinum |
10 | 3846499 | 3846549 | + | NZ_CP041091.1 | Nocardioides sambongensis |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF02896.20 | 0.6 | 6 | 3689.5 | same-strand | PEP-utilising enzyme, PEP-binding domain |
2 | PF00391.25 | 0.6 | 6 | 3689.5 | same-strand | PEP-utilising enzyme, mobile domain |
3 | PF05524.15 | 0.6 | 6 | 3689.5 | same-strand | PEP-utilising enzyme, N-terminal |
4 | PF05726.15 | 0.7 | 7 | 2665 | same-strand | Pirin C-terminal cupin domain |
5 | PF02678.18 | 0.7 | 7 | 2665 | same-strand | Pirin |
6 | PF13515.8 | 0.7 | 7 | 478 | opposite-strand | Fusaric acid resistance protein-like |
7 | PF00440.25 | 0.9 | 9 | 280.5 | same-strand | Bacterial regulatory proteins, tetR family |
8 | PF04072.16 | 0.8 | 8 | 959.5 | same-strand | Leucine carboxyl methyltransferase |
9 | PF00106.27 | 0.8 | 8 | 3337.0 | same-strand | short chain dehydrogenase |
10 | PF13561.8 | 0.7 | 7 | 3440 | same-strand | Enoyl-(Acyl carrier protein) reductase |
11 | PF08659.12 | 0.8 | 8 | 3337.0 | same-strand | KR domain |