Result : EXP01798
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01798 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 117072 |
| Right | 117119 |
| Strand | + |
| Nucleotide Sequence | GTGACGCCCAGTCGGTTGCATACTTCGGCCAATTTGAGACCGCCGTAG |
| Sequence | VTPSRLHTSANLRPP |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 10
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1543988 | 1544035 | + | NZ_CP012150.1 | Mycobacterium goodii |
| 2 | 131763 | 131810 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 3 | 7429650 | 7429697 | - | NZ_CP020809.1 | Mycobacterium dioxanotrophicus |
| 4 | 702607 | 702654 | + | NZ_AP022570.1 | Mycolicibacterium poriferae |
| 5 | 5667155 | 5667202 | - | NZ_AP022561.1 | Mycolicibacterium aichiense |
| 6 | 1968191 | 1968238 | + | NZ_AP022589.1 | Mycolicibacter minnesotensis |
| 7 | 323096 | 323143 | - | NZ_AP022560.1 | Mycolicibacterium moriokaense |
| 8 | 1356441 | 1356488 | - | NZ_AP022598.1 | Mycolicibacterium parafortuitum |
| 9 | 5801103 | 5801153 | + | NZ_AP022576.1 | Mycobacterium florentinum |
| 10 | 3846499 | 3846549 | + | NZ_CP041091.1 | Nocardioides sambongensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP012150.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02896.20 | 0.6 | 6 | 3689.5 | same-strand | PEP-utilising enzyme, PEP-binding domain |
| 2 | PF00391.25 | 0.6 | 6 | 3689.5 | same-strand | PEP-utilising enzyme, mobile domain |
| 3 | PF05524.15 | 0.6 | 6 | 3689.5 | same-strand | PEP-utilising enzyme, N-terminal |
| 4 | PF05726.15 | 0.7 | 7 | 2665 | same-strand | Pirin C-terminal cupin domain |
| 5 | PF02678.18 | 0.7 | 7 | 2665 | same-strand | Pirin |
| 6 | PF13515.8 | 0.7 | 7 | 478 | opposite-strand | Fusaric acid resistance protein-like |
| 7 | PF00440.25 | 0.9 | 9 | 280.5 | same-strand | Bacterial regulatory proteins, tetR family |
| 8 | PF04072.16 | 0.8 | 8 | 959.5 | same-strand | Leucine carboxyl methyltransferase |
| 9 | PF00106.27 | 0.8 | 8 | 3337.0 | same-strand | short chain dehydrogenase |
| 10 | PF13561.8 | 0.7 | 7 | 3440 | same-strand | Enoyl-(Acyl carrier protein) reductase |
| 11 | PF08659.12 | 0.8 | 8 | 3337.0 | same-strand | KR domain |
++ More..