Result : EXP01794
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01794 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 406707 |
| Right | 406751 |
| Strand | + |
| Nucleotide Sequence | GTGACGGACAATCCAGGACTCGGCCCGCGGGTGCCGGTGAGATGA |
| Sequence | VTDNPGLGPRVPVR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 384866 | 384910 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 1821155 | 1821199 | + | NZ_CP012150.1 | Mycobacterium goodii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF11021.10 | 1.0 | 2 | 5339.0 | opposite-strand | Protein of unknown function (DUF2613) |
| 2 | PF00933.23 | 1.0 | 2 | 4077.0 | same-strand | Glycosyl hydrolase family 3 N terminal domain |
| 3 | PF00440.25 | 1.0 | 2 | 2220.0 | same-strand | Bacterial regulatory proteins, tetR family |
| 4 | PF17918.3 | 1.0 | 2 | 2220.0 | same-strand | Tetracyclin repressor-like, C-terminal domain |
| 5 | PF17932.3 | 1.0 | 2 | 2220.0 | same-strand | Tetracyclin repressor-like, C-terminal domain |
| 6 | PF10824.10 | 1.0 | 2 | 1839.0 | same-strand | Excreted virulence factor EspC, type VII ESX diderm |
++ More..