ProsmORF-pred
Result : EXP01791
Protein Information
Information Type Description
Protein name EXP01791
NCBI Accession ID CP000480.1
Organism Mycolicibacterium smegmatis MC2 155
Left 772378
Right 772419
Strand +
Nucleotide Sequence GTGCCGCCGGCCAGCGAGGTCGACGCCGTCCACAGCGGGTAG
Sequence VPPASEVDAVHSG
Source of smORF Transcriptional-level
Function
Pubmed ID 32181921
Domain
Functional Category Function not yet assigned
Uniprot ID
ORF Length (Amino Acid) 13
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 73
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 809020 809061 + NZ_LN831039.1 Mycolicibacterium smegmatis
2 3793163 3793204 + NC_022663.1 Mycobacterium kansasii ATCC 12478
3 6171144 6171185 - NZ_AP022560.1 Mycolicibacterium moriokaense
4 561420 561461 + NZ_AP018164.1 Mycobacterium shigaense
5 4750142 4750183 - NZ_CP009360.4 Mycobacterium avium subsp. hominissuis
6 4087623 4087664 - NZ_AP022581.1 Mycobacterium lacus
7 329669 329710 + NZ_LT906469.1 Mycolicibacter terrae
8 410422 410463 + NC_015848.1 Mycobacterium canettii CIPT 140010059
9 402663 402704 + NC_000962.3 Mycobacterium tuberculosis H37Rv
10 414595 414636 + NZ_CP011883.2 Mycobacterium haemophilum DSM 44634
11 2907400 2907441 - NZ_CP029543.1 Mycobacterium leprae
12 6766541 6766582 - NZ_CP020809.1 Mycobacterium dioxanotrophicus
13 5020406 5020447 + NZ_CP042266.1 Streptomyces qinzhouensis
14 5157458 5157499 + NZ_CP020700.1 Streptomyces tsukubensis
15 1184601 1184642 + NZ_CP042260.1 Glutamicibacter halophytocola
16 2420733 2420774 + NZ_CP033081.1 Glutamicibacter nicotianae
17 3687075 3687116 - NZ_AP022614.1 Mycobacterium parmense
18 4047580 4047621 - NZ_CP019343.1 Oceanicoccus sagamiensis
19 1848871 1848912 + NZ_AP022588.1 Mycolicibacterium sediminis
20 4583849 4583890 + NZ_AP022619.1 Mycobacterium paraseoulense
21 4317611 4317652 - NZ_AP022573.1 Mycobacterium saskatchewanense
22 1006548 1006589 + NZ_AP022570.1 Mycolicibacterium poriferae
23 4789223 4789264 + NZ_AP022582.1 Mycobacterium seoulense
24 5051566 5051607 - NC_016948.1 Mycobacterium paraintracellulare
25 1899849 1899890 - NZ_AP022599.1 Mycolicibacterium pulveris
26 4925889 4925930 - NC_016946.1 Mycobacterium intracellulare ATCC 13950
27 3977866 3977907 + NZ_AP022569.1 Mycobacterium cookii
28 4789112 4789153 - NZ_CP023147.1 Mycobacterium marseillense
29 3440264 3440305 - NZ_AP022575.1 Mycobacterium shinjukuense
30 1612230 1612271 - NZ_AP022562.1 Mycobacterium novum
31 1425627 1425668 - NZ_AP022567.1 Mycolicibacterium mageritense
32 4764076 4764117 + NZ_AP022608.1 Mycolicibacterium gadium
33 1591193 1591234 - NZ_AP022615.1 Mycobacterium heidelbergense
34 405843 405884 - NZ_CP012150.1 Mycobacterium goodii
35 2055383 2055424 - NZ_AP022568.1 Mycobacterium simiae
36 4945897 4945938 + NZ_LR026975.1 Mycolicibacterium hassiacum DSM 44199
37 380512 380553 + NZ_LT906483.1 Mycolicibacterium thermoresistibile
38 192059 192100 + NZ_AP022613.1 Mycobacterium conspicuum
39 661987 662028 + NC_008726.1 Mycolicibacterium vanbaalenii PYR-1
40 933719 933760 - NZ_AP022600.1 Mycolicibacterium tokaiense
41 437049 437090 + NZ_CP062008.1 Mycolicibacterium mucogenicum DSM 44124
42 4479358 4479399 - NZ_AP022612.1 Mycolicibacterium confluentis
43 729402 729443 + NZ_AP022610.1 Mycolicibacterium madagascariense
44 2032748 2032789 + NZ_AP022595.1 Mycolicibacterium sarraceniae
45 784923 784964 - NZ_CP061539.1 Rothia terrae
46 3084090 3084131 - NZ_AP022576.1 Mycobacterium florentinum
47 3396252 3396293 - NZ_AP022587.1 Mycobacterium stomatepiae
48 2278189 2278230 + NZ_AP022583.1 Mycobacterium noviomagense
49 776223 776264 + NZ_CP025546.1 Mycobacterium paragordonae
50 2146118 2146159 + NZ_CP058277.1 Mycobacterium marinum
51 781199 781240 + NZ_AP018410.1 Mycobacterium pseudoshottsii JCM 15466
52 2199857 2199898 + NZ_AP022572.1 Mycobacterium shottsii
53 6044860 6044901 + NZ_CP031455.1 Streptomyces olivoreticuli subsp. olivoreticuli
54 3936991 3937032 + NZ_CP054938.1 Streptomyces harbinensis
55 556925 556966 + NZ_LR130759.1 Mycobacterium basiliense
56 480519 480560 + NZ_CP011491.1 Mycolicibacterium vaccae 95051
57 4402577 4402618 - NZ_AP022617.1 Mycolicibacterium monacense
58 464915 464956 - NZ_AP022574.1 Mycolicibacterium psychrotolerans
59 3859689 3859730 - NZ_AP022586.1 Mycolicibacterium litorale
60 190033 190074 + NZ_AP022605.1 Mycobacterium doricum
61 5264601 5264642 + NC_016109.1 Kitasatospora setae KM-6054
62 3323306 3323347 - NZ_CP032698.1 Streptomyces hundungensis
63 3063990 3064031 - NZ_CP023698.1 Streptomyces viridifaciens
64 4891519 4891560 + NZ_CP031742.1 Streptomyces koyangensis
65 4142773 4142814 + NC_016111.1 Streptomyces cattleya NRRL 8057 = DSM 46488
66 3856209 3856250 - NZ_AP022590.1 Mycobacterium mantenii
67 467847 467888 + NZ_LR134356.1 Mycolicibacterium aurum
68 4937697 4937738 - NZ_CP011530.1 Mycobacteroides immunogenum
69 2289014 2289055 - NZ_CP039247.1 Corynebacterium endometrii
70 2083730 2083771 - NZ_CP011312.1 Corynebacterium kutscheri
71 5589895 5589936 + NZ_CP023691.1 Streptomyces platensis
72 5426489 5426530 + NZ_CP019457.1 Streptomyces lydicus
73 7810254 7810295 + NZ_AP017900.1 Nocardia seriolae
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NZ_LN831039.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF00155.23 1.0 73 -41 opposite-strand Aminotransferase class I and II
2 PF02754.18 0.75 55 494 opposite-strand Cysteine-rich domain
3 PF13183.8 0.75 55 494 opposite-strand 4Fe-4S dicluster domain
4 PF13187.8 0.75 55 494 opposite-strand 4Fe-4S dicluster domain
5 PF13237.8 0.75 55 494 opposite-strand 4Fe-4S dicluster domain
++ More..