Result : EXP01790
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01790 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 5778189 |
| Right | 5778230 |
| Strand | + |
| Nucleotide Sequence | GTGCGCCGCGGATCACGCGGTGCCCAAAGCGGATTGACCTGA |
| Sequence | VRRGSRGAQSGLT |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 13 |
++ More..
| Conservation Analysis |
No. of Species: 15
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2354278 | 2354319 | - | NZ_AP022579.1 | Mycolicibacterium boenickei |
| 2 | 5788607 | 5788648 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 3 | 1154645 | 1154686 | + | NZ_AP022567.1 | Mycolicibacterium mageritense |
| 4 | 2592877 | 2592918 | - | NZ_CP012150.1 | Mycobacterium goodii |
| 5 | 4661232 | 4661273 | - | NZ_AP022565.1 | Mycolicibacterium alvei |
| 6 | 5360471 | 5360512 | - | NZ_AP022563.1 | Mycolicibacterium duvalii |
| 7 | 6225860 | 6225901 | + | NZ_AP022588.1 | Mycolicibacterium sediminis |
| 8 | 5391663 | 5391704 | + | NC_008726.1 | Mycolicibacterium vanbaalenii PYR-1 |
| 9 | 1848520 | 1848561 | - | NZ_AP022574.1 | Mycolicibacterium psychrotolerans |
| 10 | 5376679 | 5376720 | + | NZ_AP022570.1 | Mycolicibacterium poriferae |
| 11 | 3640303 | 3640344 | + | NZ_AP022601.1 | Mycobacterium gallinarum |
| 12 | 3509920 | 3509961 | + | NZ_AP022608.1 | Mycolicibacterium gadium |
| 13 | 795707 | 795745 | - | NZ_AP018165.1 | [Mycobacterium] stephanolepidis |
| 14 | 799938 | 799976 | - | NZ_CP007220.1 | Mycobacteroides chelonae CCUG 47445 |
| 15 | 1468511 | 1468552 | - | NZ_AP022560.1 | Mycolicibacterium moriokaense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07690.18 | 0.93 | 14 | 1409.5 | same-strand | Major Facilitator Superfamily |
| 2 | PF11228.10 | 1.0 | 15 | 484 | opposite-strand | Protein of unknown function (DUF3027) |
| 3 | PF10604.11 | 0.93 | 14 | 15.0 | same-strand | Polyketide cyclase / dehydrase and lipid transport |
| 4 | PF00588.21 | 1.0 | 15 | 726 | opposite-strand | SpoU rRNA Methylase family |
| 5 | PF10801.10 | 1.0 | 15 | 1557 | opposite-strand | Protein of unknown function (DUF2537) |
| 6 | PF11268.10 | 1.0 | 15 | 1874 | same-strand | Protein of unknown function (DUF3071) |
| 7 | PF00266.21 | 0.73 | 11 | 2744 | same-strand | Aminotransferase class-V |
| 8 | PF10969.10 | 0.93 | 14 | 3053.0 | same-strand | Protein of unknown function (DUF2771) |
| 9 | PF13410.8 | 0.67 | 10 | 3550.5 | opposite-strand | Glutathione S-transferase, C-terminal domain |
| 10 | PF13409.8 | 0.67 | 10 | 3550.5 | opposite-strand | Glutathione S-transferase, N-terminal domain |
++ More..