Result : EXP01789

Protein Information

• Protein name: EXP01789
• NCBI Accession ID: CP000480.1
• Organism: Mycolicibacterium smegmatis MC2 155
• Left: 3756969
• Right: 3757010
• Strand: +
• Nucleotide Sequence: GTGACGCCCGAGAGCGTCGCACAGCGACTTCGAGAGGTGTGA
• Sequence: VTPESVAQRLREV
• Source of smORF: Transcriptional-level
• Pubmed ID: 32181921
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 13

Conservation Analysis

No. of Species: 9

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	4590220	4590261	-	NZ_CP012150.1	Mycobacterium goodii
2	3816556	3816597	+	NZ_LN831039.1	Mycolicibacterium smegmatis
3	529032	529076	+	NZ_AP022613.1	Mycobacterium conspicuum
4	1341768	1341812	+	NZ_CP020809.1	Mycobacterium dioxanotrophicus
5	2570761	2570805	+	NZ_AP022583.1	Mycobacterium noviomagense
6	3094731	3094772	-	NZ_AP022587.1	Mycobacterium stomatepiae
7	2788264	2788305	-	NZ_AP022576.1	Mycobacterium florentinum
8	3581883	3581927	-	NZ_AP022590.1	Mycobacterium mantenii
9	1958635	1958676	-	NZ_CP025546.1	Mycobacterium paragordonae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NZ_CP012150.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF08544.15	1.0	9	-3	same-strand	GHMP kinases C terminal
2	PF00288.28	1.0	9	-3	same-strand	GHMP kinases N terminal domain