| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01789 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 3756969 |
| Right | 3757010 |
| Strand | + |
| Nucleotide Sequence | GTGACGCCCGAGAGCGTCGCACAGCGACTTCGAGAGGTGTGA |
| Sequence | VTPESVAQRLREV |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 13 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4590220 | 4590261 | - | NZ_CP012150.1 | Mycobacterium goodii |
| 2 | 3816556 | 3816597 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 3 | 529032 | 529076 | + | NZ_AP022613.1 | Mycobacterium conspicuum |
| 4 | 1341768 | 1341812 | + | NZ_CP020809.1 | Mycobacterium dioxanotrophicus |
| 5 | 2570761 | 2570805 | + | NZ_AP022583.1 | Mycobacterium noviomagense |
| 6 | 3094731 | 3094772 | - | NZ_AP022587.1 | Mycobacterium stomatepiae |
| 7 | 2788264 | 2788305 | - | NZ_AP022576.1 | Mycobacterium florentinum |
| 8 | 3581883 | 3581927 | - | NZ_AP022590.1 | Mycobacterium mantenii |
| 9 | 1958635 | 1958676 | - | NZ_CP025546.1 | Mycobacterium paragordonae |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF08544.15 | 1.0 | 9 | -3 | same-strand | GHMP kinases C terminal |
| 2 | PF00288.28 | 1.0 | 9 | -3 | same-strand | GHMP kinases N terminal domain |