Result : EXP01788
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01788 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 2863607 |
| Right | 2863648 |
| Strand | + |
| Nucleotide Sequence | GTGACTATCGGTGTGTGCGCCTCGTATTGGCGCTTTATCTAG |
| Sequence | VTIGVCASYWRFI |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 13 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2929984 | 2930025 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 5442751 | 5442792 | - | NZ_CP012150.1 | Mycobacterium goodii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07729.14 | 1.0 | 2 | 3555.0 | opposite-strand | FCD domain |
| 2 | PF00392.23 | 1.0 | 2 | 3555.0 | opposite-strand | Bacterial regulatory proteins, gntR family |
| 3 | PF07690.18 | 1.0 | 2 | 2264 | same-strand | Major Facilitator Superfamily |
| 4 | PF03466.22 | 1.0 | 2 | 112.5 | opposite-strand | LysR substrate binding domain |
| 5 | PF00126.29 | 1.0 | 2 | 112.5 | opposite-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 6 | PF00793.22 | 1.0 | 2 | 140.0 | same-strand | DAHP synthetase I family |
| 7 | PF03358.17 | 1.0 | 2 | 3086.5 | opposite-strand | NADPH-dependent FMN reductase |
++ More..