Protein Information |
Information Type | Description |
---|---|
Protein name | EXP01785 |
NCBI Accession ID | CP000480.1 |
Organism | Mycolicibacterium smegmatis MC2 155 |
Left | 6334571 |
Right | 6334612 |
Strand | + |
Nucleotide Sequence | GTGCAGCGGGTGCTCCTTCTCGGACGCCGCGGCGGGGTCTGA |
Sequence | VQRVLLLGRRGGV |
Source of smORF | Transcriptional-level |
Function | |
Pubmed ID | 32181921 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 13 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4888450 | 4888491 | - | NZ_AP022586.1 | Mycolicibacterium litorale |
2 | 3461797 | 3461838 | + | NZ_AP022605.1 | Mycobacterium doricum |
3 | 4345150 | 4345191 | - | NZ_AP022587.1 | Mycobacterium stomatepiae |
4 | 2945394 | 2945435 | - | NZ_AP022568.1 | Mycobacterium simiae |
5 | 792604 | 792645 | + | NZ_CP043474.1 | Mycobacterium grossiae |
6 | 5255544 | 5255585 | + | NZ_AP022610.1 | Mycolicibacterium madagascariense |
7 | 3938581 | 3938622 | + | NZ_CP011883.2 | Mycobacterium haemophilum DSM 44634 |
8 | 5753420 | 5753461 | - | NZ_AP022612.1 | Mycolicibacterium confluentis |
9 | 983636 | 983677 | - | NZ_CP022208.1 | Rhodococcus pyridinivorans |
10 | 5623445 | 5623486 | + | NZ_CP011491.1 | Mycolicibacterium vaccae 95051 |
11 | 732728 | 732769 | + | NZ_CP012150.1 | Mycobacterium goodii |
12 | 4243377 | 4243418 | + | NC_015576.1 | Mycolicibacter sinensis |
13 | 4167902 | 4167943 | + | NZ_LT906469.1 | Mycolicibacter terrae |
14 | 2385996 | 2386037 | - | NZ_AP022562.1 | Mycobacterium novum |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00682.21 | 1.0 | 14 | 77.5 | same-strand | HMGL-like |
2 | PF08502.12 | 1.0 | 14 | 77.5 | same-strand | LeuA allosteric (dimerisation) domain |
3 | PF00929.26 | 0.71 | 10 | 2019.5 | opposite-strand | Exonuclease |
4 | PF08353.12 | 0.71 | 10 | 3185.5 | same-strand | MurT ligase C-terminal |