Result : EXP01783
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01783 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 4942300 |
| Right | 4942338 |
| Strand | + |
| Nucleotide Sequence | ATGCTCTCCCGACTCGACAAGCATCTGAGCCGTCCGTGA |
| Sequence | MLSRLDKHLSRP |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 12 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3465333 | 3465371 | - | NZ_CP012150.1 | Mycobacterium goodii |
| 2 | 4950626 | 4950664 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP012150.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02515.19 | 1.0 | 2 | 2700.0 | opposite-strand | CoA-transferase family III |
| 2 | PF13561.8 | 1.0 | 2 | 1445.5 | both-strands | Enoyl-(Acyl carrier protein) reductase |
| 3 | PF00106.27 | 1.0 | 2 | 1445.5 | both-strands | short chain dehydrogenase |
| 4 | PF08659.12 | 1.0 | 2 | 1026 | same-strand | KR domain |
| 5 | PF00440.25 | 1.0 | 2 | -3.0 | same-strand | Bacterial regulatory proteins, tetR family |
| 6 | PF00378.22 | 1.0 | 2 | 170.0 | opposite-strand | Enoyl-CoA hydratase/isomerase |
| 7 | PF00441.26 | 1.0 | 2 | 2138.0 | same-strand | Acyl-CoA dehydrogenase, C-terminal domain |
| 8 | PF02770.21 | 1.0 | 2 | 2542.5 | same-strand | Acyl-CoA dehydrogenase, middle domain |
| 9 | PF02771.18 | 1.0 | 2 | 2542.5 | same-strand | Acyl-CoA dehydrogenase, N-terminal domain |
| 10 | PF13577.8 | 1.0 | 2 | 3665.5 | same-strand | SnoaL-like domain |
++ More..