Result : EXP01781
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01781 |
| NCBI Accession ID | CP000480.1 |
| Organism | Mycolicibacterium smegmatis MC2 155 |
| Left | 447603 |
| Right | 447641 |
| Strand | + |
| Nucleotide Sequence | ATGTTTGCGATGTCCGCTGAACAGCCGGGAGAAACGTGA |
| Sequence | MFAMSAEQPGET |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 32181921 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 12 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 425615 | 425653 | + | NZ_LN831039.1 | Mycolicibacterium smegmatis |
| 2 | 1887703 | 1887741 | + | NZ_CP012150.1 | Mycobacterium goodii |
| 3 | 2446762 | 2446800 | - | NZ_AP022567.1 | Mycolicibacterium mageritense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LN831039.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13578.8 | 1.0 | 3 | 4138 | same-strand | Methyltransferase domain |
| 2 | PF08484.13 | 1.0 | 3 | 2887 | opposite-strand | C-methyltransferase C-terminal domain |
| 3 | PF13489.8 | 1.0 | 3 | 2887 | opposite-strand | Methyltransferase domain |
| 4 | PF08241.14 | 1.0 | 3 | 2887 | opposite-strand | Methyltransferase domain |
| 5 | PF13649.8 | 1.0 | 3 | 2887 | opposite-strand | Methyltransferase domain |
| 6 | PF08242.14 | 1.0 | 3 | 2887 | opposite-strand | Methyltransferase domain |
| 7 | PF03621.15 | 1.0 | 3 | -3 | same-strand | MbtH-like protein |
| 8 | PF00668.22 | 1.0 | 3 | 5360.0 | same-strand | Condensation domain |
| 9 | PF00501.30 | 1.0 | 3 | 5360.0 | same-strand | AMP-binding enzyme |
| 10 | PF00550.27 | 1.0 | 3 | 5360.0 | same-strand | Phosphopantetheine attachment site |
| 11 | PF13193.8 | 1.0 | 3 | 5360.0 | same-strand | AMP-binding enzyme C-terminal domain |
| 12 | PF07993.14 | 1.0 | 3 | 10534 | same-strand | Male sterility protein |
| 13 | PF11139.10 | 1.0 | 3 | 18231 | same-strand | Sap, sulfolipid-1-addressing protein |
++ More..