Protein Information |
Information Type | Description |
---|---|
Protein name | EXP01715 |
NCBI Accession ID | NC_000913.3 |
Organism | Escherichia coli K12 |
Left | 1151500 |
Right | 1151556 |
Strand | - |
Nucleotide Sequence | TTGAAAAATTTGCAACTAAATCCCGGCAGGTCTTACCACGATTTTACGTTATTTTGA |
Sequence | LKNLQLNPGRSYHDFTLF |
Source of smORF | Literature |
Function | |
Pubmed ID | 30796087 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 18 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1510736 | 1510792 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 3625318 | 3625374 | + | NZ_CP045205.1 | Citrobacter telavivensis |
3 | 3277586 | 3277642 | + | NZ_CP014007.2 | Kosakonia oryzae |
4 | 3445404 | 3445460 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
5 | 486577 | 486633 | + | NZ_CP044098.1 | Citrobacter portucalensis |
6 | 1159597 | 1159653 | - | NZ_AP014857.1 | Escherichia albertii |
7 | 1151500 | 1151556 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
8 | 1139217 | 1139273 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
9 | 3670049 | 3670105 | - | NZ_CP053416.1 | Salmonella bongori |
10 | 1794442 | 1794498 | - | NZ_LR134340.1 | Escherichia marmotae |
11 | 1732528 | 1732584 | - | NZ_CP061527.1 | Shigella dysenteriae |
12 | 1713388 | 1713444 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
13 | 1793703 | 1793759 | - | NZ_CP009756.1 | Enterobacter cloacae |
14 | 1766430 | 1766486 | - | NC_015968.1 | Enterobacter soli |
15 | 2996300 | 2996356 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
16 | 1746918 | 1746974 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
17 | 1781328 | 1781384 | - | NZ_AP022508.1 | Enterobacter bugandensis |
18 | 4269834 | 4269890 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
19 | 1547087 | 1547143 | + | NZ_CP038469.1 | Citrobacter tructae |
20 | 3466235 | 3466291 | + | NZ_CP054254.1 | Klebsiella variicola |
21 | 2036045 | 2036101 | - | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
22 | 3217961 | 3218017 | + | NZ_CP065838.1 | Klebsiella quasipneumoniae |
23 | 4631571 | 4631627 | - | NZ_CP033744.1 | Citrobacter freundii |
24 | 875659 | 875715 | + | NZ_CP057657.1 | Escherichia fergusonii |
25 | 1920297 | 1920353 | - | NZ_CP015113.1 | Kosakonia radicincitans |
26 | 2543439 | 2543495 | - | NZ_CP051548.1 | Phytobacter diazotrophicus |
27 | 1120456 | 1120512 | + | NZ_CP045300.1 | Kosakonia arachidis |
28 | 1918433 | 1918489 | - | NZ_CP063425.1 | Kosakonia pseudosacchari |
29 | 1150425 | 1150481 | + | NZ_CP016337.1 | Kosakonia sacchari |
30 | 1834783 | 1834839 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
31 | 2838033 | 2838089 | + | NZ_CP035129.1 | Kosakonia cowanii |
32 | 2016739 | 2016795 | - | NZ_CP043318.1 | Enterobacter chengduensis |
33 | 962297 | 962353 | - | NZ_CP017279.1 | Enterobacter ludwigii |
34 | 760002 | 760058 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
35 | 1812947 | 1813003 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
36 | 2462184 | 2462240 | + | NC_017910.1 | Shimwellia blattae DSM 4481 = NBRC 105725 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF01783.25 | 1.0 | 35 | 3890.0 | opposite-strand | Ribosomal L32p protein family |
2 | PF02504.17 | 0.91 | 32 | 2763 | opposite-strand | Fatty acid synthesis protein |
3 | PF08541.12 | 1.0 | 35 | 1733.0 | opposite-strand | 3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III C terminal |
4 | PF08545.12 | 1.0 | 35 | 1733.0 | opposite-strand | 3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III |
5 | PF01154.19 | 0.77 | 27 | 1733.0 | opposite-strand | Hydroxymethylglutaryl-coenzyme A synthase N terminal |
6 | PF00698.23 | 1.0 | 35 | 787.0 | opposite-strand | Acyl transferase domain |
7 | PF13561.8 | 1.0 | 35 | 40.0 | opposite-strand | Enoyl-(Acyl carrier protein) reductase |
8 | PF00106.27 | 1.0 | 35 | 40.0 | opposite-strand | short chain dehydrogenase |
9 | PF08659.12 | 1.0 | 35 | 40.0 | opposite-strand | KR domain |
10 | PF13460.8 | 1.0 | 35 | 40.0 | opposite-strand | NAD(P)H-binding |
11 | PF00550.27 | 1.0 | 35 | 59.0 | opposite-strand | Phosphopantetheine attachment site |
12 | PF00109.28 | 1.0 | 35 | 385.0 | opposite-strand | Beta-ketoacyl synthase, N-terminal domain |
13 | PF02801.24 | 1.0 | 35 | 385.0 | opposite-strand | Beta-ketoacyl synthase, C-terminal domain |
14 | PF01063.21 | 1.0 | 35 | 1747.5 | opposite-strand | Amino-transferase class IV |
15 | PF02618.18 | 1.0 | 35 | 2559.5 | opposite-strand | YceG-like family |
16 | PF02223.19 | 0.97 | 34 | 3571 | opposite-strand | Thymidylate kinase |
17 | PF13521.8 | 0.94 | 33 | 3571.5 | opposite-strand | AAA domain |