Result : EXP01686
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01686 |
| NCBI Accession ID | CP003904.1 |
| Organism | Helicobacter pylori |
| Left | 838697 |
| Right | 838780 |
| Strand | - |
| Nucleotide Sequence | ATGCCAAGCGCTGCTTGTAAAACAGCAACAAAAATAACTGTAAACAACACAGATTACGCTCCAGCTTACGCTAAAGCTGCGTGA |
| Sequence | MPSAACKTATKITVNNTDYAPAYAKAA |
| Source of smORF | Literature |
| Function | |
| Pubmed ID | 30796087 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 788870 | 788953 | - | NC_017379.1 | Helicobacter pylori Puno135 |
| 2 | 790184 | 790267 | - | NC_008229.1 | Helicobacter acinonychis str. Sheeba |
| 3 | 413229 | 413312 | + | NC_014810.2 | Helicobacter felis ATCC 49179 |
| 4 | 1527374 | 1527454 | - | NZ_CP007773.1 | Campylobacter subantarcticus LMG 24377 |
| 5 | 210683 | 210754 | - | NC_014935.1 | Nitratifractor salsuginis DSM 16511 |
++ More..