Result : EXP01677
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP01677 |
| NCBI Accession ID | BA000022.2 |
| Organism | Synechocystis sp. PCC 6803 |
| Left | 837994 |
| Right | 838215 |
| Strand | - |
| Nucleotide Sequence | ATGGCTCTTCCCAACATTGCAGACGCAAGGAAACTCGGCGACGAAGAATTGGCCACTGAAATCTTAGCCACCAAGCAAAGATTGTTCCAACTCCGGTTCCAACAGGCTACCCGTCGTCCCGAAAACCCCCATGAATTTAAACATGCCCGCCATCGCTTGGCTCAACTCTTAACGGTGGAACGGGAACGACAACTTGAGAATAGCCCTTCTGAGGAGGCATAA |
| Sequence | MALPNIADARKLGDEELATEILATKQRLFQLRFQQATRRPENPHEFKHARHRLAQLLTVERERQLENSPSEEA |
| Source of smORF | Protein-level |
| Function | translation [GO:0006412];ribosome [GO:0005840];structural constituent of ribosome [GO:0003735] The ORF matches to the profile of cl09943. Profile Description: N/A. This family represents the N-terminal region (approximately 8 residues) of the eukaryotic mitochondrial 39-S ribosomal protein L47 (MRP-L47). Mitochondrial ribosomal proteins (MRPs) are the counterparts of the cytoplasmic ribosomal proteins, in that they fulfil similar functions in protein biosynthesis. However, they are distinct in number, features and primary structure. |
| Pubmed ID | 30796087 |
| Domain | CDD:415815 |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | Q110B5 |
| ORF Length (Amino Acid) | 73 |
++ More..
| Conservation Analysis |
No. of Species: 26
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 5491608 | 5491853 | - | NC_014501.1 | Gloeothece verrucosa PCC 7822 |
| 2 | 4140614 | 4140844 | + | NC_011729.1 | Gloeothece citriformis PCC 7424 |
| 3 | 5189658 | 5189864 | + | NZ_AP014638.1 | Leptolyngbya boryana IAM M-101 |
| 4 | 2618214 | 2618456 | - | NC_019753.1 | Crinalium epipsammum PCC 9333 |
| 5 | 217184 | 217417 | - | NC_019695.1 | Chroococcidiopsis thermalis PCC 7203 |
| 6 | 174242 | 174469 | - | NZ_CP060822.1 | Cylindrospermopsis curvispora GIHE-G1 |
| 7 | 4468984 | 4469211 | + | NC_019771.1 | Anabaena cylindrica PCC 7122 |
| 8 | 6461500 | 6461715 | - | NC_019751.1 | Calothrix sp. PCC 6303 |
| 9 | 2669021 | 2669248 | + | NC_014248.1 | 'Nostoc azollae' 0708 |
| 10 | 1924258 | 1924491 | + | NZ_CP042326.1 | Euhalothece natronophila Z-M001 |
| 11 | 2171016 | 2171240 | + | NZ_CP047242.1 | Trichormus variabilis 0441 |
| 12 | 5461982 | 5462209 | - | NC_010628.1 | Nostoc punctiforme PCC 73102 |
| 13 | 5287593 | 5287811 | - | NC_010296.1 | Microcystis aeruginosa NIES-843 |
| 14 | 5627737 | 5627964 | + | NZ_CP054698.1 | Nostoc edaphicum CCNP1411 |
| 15 | 6148686 | 6148913 | + | NZ_CP024785.1 | Nostoc flagelliforme CCNUN1 |
| 16 | 4000279 | 4000506 | + | NZ_CP031941.1 | Nostoc sphaeroides |
| 17 | 645007 | 645240 | - | NC_019776.1 | Cyanobacterium aponinum PCC 10605 |
| 18 | 4580995 | 4581210 | - | NC_019748.1 | Stanieria cyanosphaera PCC 7437 |
| 19 | 4115144 | 4115356 | - | NC_005125.1 | Gloeobacter violaceus PCC 7421 |
| 20 | 3765277 | 3765537 | + | NC_019780.1 | Dactylococcopsis salina PCC 8305 |
| 21 | 61584 | 61796 | - | NZ_CP018092.1 | Synechococcus lividus PCC 6715 |
| 22 | 1757565 | 1757777 | + | NC_019675.1 | Cyanobium gracile PCC 6307 |
| 23 | 2470913 | 2471125 | - | NZ_AP018202.1 | Thermostichus vulcanus NIES-2134 |
| 24 | 77699 | 77911 | + | NC_004113.1 | Thermosynechococcus vestitus BP-1 |
| 25 | 3394194 | 3394418 | + | NC_019693.1 | Oscillatoria acuminata PCC 6304 |
| 26 | 2780310 | 2780522 | - | NC_022600.1 | Gloeobacter kilaueensis JS1 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_014501.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00410.21 | 0.92 | 24 | 1698.5 | same-strand | Ribosomal protein S8 |
| 2 | PF00673.23 | 1.0 | 26 | 1125.0 | same-strand | ribosomal L5P family C-terminus |
| 3 | PF00281.21 | 1.0 | 26 | 1125.0 | same-strand | Ribosomal protein L5 |
| 4 | PF17136.6 | 1.0 | 26 | 669.0 | same-strand | Ribosomal proteins 50S L24/mitochondrial 39S L24 |
| 5 | PF00467.31 | 1.0 | 26 | 669.0 | same-strand | KOW motif |
| 6 | PF00238.21 | 1.0 | 26 | 297.5 | same-strand | Ribosomal protein L14p/L23e |
| 7 | PF00366.22 | 1.0 | 26 | 7.0 | same-strand | Ribosomal protein S17 |
| 8 | PF00252.20 | 1.0 | 26 | 4.0 | same-strand | Ribosomal protein L16p/L10e |
| 9 | PF00189.22 | 1.0 | 26 | 501.5 | same-strand | Ribosomal protein S3, C-terminal domain |
| 10 | PF07650.19 | 1.0 | 26 | 501.5 | same-strand | KH domain |
| 11 | PF00237.21 | 1.0 | 26 | 1296.0 | same-strand | Ribosomal protein L22p/L17e |
| 12 | PF00203.23 | 0.92 | 24 | 1753.5 | same-strand | Ribosomal protein S19 |
| 13 | PF03947.20 | 0.92 | 24 | 2127.5 | same-strand | Ribosomal Proteins L2, C-terminal domain |
| 14 | PF00181.25 | 0.92 | 24 | 2127.5 | same-strand | Ribosomal Proteins L2, RNA binding domain |
++ More..